Toxicological impact and histopathological response of tilapia after lead (II) nitrate (pb (n03)2) contamination

... 1153110007 Thesis Title : Toxicological Effect and Histopathological Alterations on Fish after Insecticide Active Compound Contamination Supervisor (s): Dr Arinafril Dr Ho Ngoc Son Abstract: Deltamethrin, ... diazinon and deltamethrin concentrations Fish Physiology and Biochemistry, 40(3), 715-720 Jeheshadevi, A.K, Ramya, T.M, Sridhar, S and Chandra, J H (2014)...

Ngày tải lên: 28/04/2016, 13:44

... metal pollutants in water, this study with the topic is Hydrilla verticillata, a submerged aquatic plant, as phytoremediation agent of Lead (II)-Nitrate (Pb(NO3)2) was carefully conducted and ... Title : HYDRILLA VERTICILLATA, A SUBMERGED AQUATIC PLANT, AS PHYTOREMEDIATION AGENT OF LEAD (II)NITRATE (PB(NO3)2) Supervisor (s): Dr Arinafril...

Ngày tải lên: 10/10/2016, 15:19

... bioavailability of PNA after conjugation with natural CPPs [3–8], an almost one order of magnitude higher intracellular PNA concentration was achieved after exposing cells to the MAP PNA conjugate ... Oehlke et al (Eur J Biochem 271) Table Sequences of the PNA derivatives studied Compound Sequence MAP I KLALKLALKALKAALKLA-NH2 Fluos-GGAGCAGGAAAG-Lys (antisense) Fluos-G...

Ngày tải lên: 23/03/2014, 13:20

... simulated the shock and friction process of nanofluids, the micro-rotation motion of nanoparticles in the shock and friction process is Page of visually observed by molecular dynamics simulations Therefore, ... translation motion, The motion states of nanoparticles between plates in the processes of impact and friction under two compressed Figure The...

Ngày tải lên: 21/06/2014, 05:20

... pihsralohcS tireM ytisrevinU a fo mrof eht ni ytisrevinU secneicS laminA dna yranireteV veD dagnA uruG morf deviecer ecnatsissa laicnanif eht segdelwonkca ylud rohtua roines ehT stnemgdelwonkcA ... elirets ni deraperp saw noisnepsus a dna ,h 42 rof Co73 ta oN muidem no derutluc erew smsinagro tset ehT msinagro tset eht sa )937 CCTM( gnisu ]2[ euqinhcet yassaoib lacigoloiborcim dradnats a yb ....

Ngày tải lên: 07/08/2014, 20:23

... physical (climatic) variables that most strongly influence tree species composition in the forests of the Vosges Mountains; (2) estimate the response of tree species according to the main environmental ... response of the most frequent tree species in the Vosges natural forest, according to the key environmental predictors explaining stand compositi...

Ngày tải lên: 08/08/2014, 00:22

... from zero) Means of Pr and Pb were 32.6% and 6.6%, for the natural regeneration, 13.5% and 2.6 % for the potted saplings in northeastern France, and 10% and 2.1% for the potted saplings in southern ... in north-eastern France (plots and linear regression) and southern France (mean, standard deviation and confidence interval of the mean), and for the saplings of...

Ngày tải lên: 08/08/2014, 00:22

... morphological characteristics, and in root growth potential and flushing response of rooted cuttings derived from selected material compared with unimproved transplants of Sitka spruce grown in Ireland ... effects of selection and propagation Several morphological variables, root growth potential and dormancy intensity of planting stock raised fro...

Ngày tải lên: 08/08/2014, 14:21

... repeated measurement component (γ was excluded ) n Linear regression analysis of SLA as a function of nutrient concentration was undertaken to compare the slope of the relationship among spacings ... between the 1.0 m and 1.5 m spacings Leaf biomass and leaf area did not differ significantly among spacings (table IV) For each spacing, differences in leaf biomass...

Ngày tải lên: 08/08/2014, 14:21

... proteins with yield of 0.05 mg per 100 ml cells These recombinant proteins could elicit specific antibody response against avian influenza virus (H5N1) antigen tested by ELISA The protecting antibody ... and COS-7 cellls, were administered in mice in combination with adjuvant, was capable of eliciting antibody specific for avian influenza virus, detect...

Ngày tải lên: 11/08/2014, 10:23

... calculation of ␭ after the intravenous and the intramuscular administration all plasma samples from 2.5 h and onwards were included After oral administration of the drug all time points from h and further ... obtained after oral administration of flunixin to goats (n=6) Data after intravenous administration are shown as a reference Acta vet scand vol 44 no 3...

Ngày tải lên: 12/08/2014, 15:20

... is, how the labor supply of child moves with changes in the labor supply of child depends on their relative productivities and the household s preferences over the labor supply of each child Plugging ... Because of the assumptions on h, the more productive child works more than the less productive child The solution to the household' s pro...

Ngày tải lên: 25/04/2016, 08:10

... which is capable of solving the unphysical response of the MFH model in the interested deformation range HYPERELASTIC MATERIAL MODEL The stress tensors of homogeneous hyperelastic materials are ... applicable to any kind of tissues or fibre- reinforced materials showing anisotropy However, the interaction between the fibres and the matrix should be considered and will...

Ngày tải lên: 08/06/2016, 14:11

... the contribution of the N- and C-terminal regions of GCPII to its enzymatic properties and structure /folding The results clearly show that the amino acids at the extreme C-terminus of GCPII are ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAA...

Ngày tải lên: 07/03/2014, 15:20