Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology
Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology
... Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology Master of Science Thesis For obtaining the degree ... into a scenario generating process used by the Asset Liability Management (ALM) approach of pension funds In order to develop such a...
Ngày tải lên: 11/12/2016, 20:47
Does a Causal Link Exist between Foreign Direct Investment and Economic Growth in the Asian NIEs
... the causal links between FDI and GDP and the causality of these two variables by looking at a sample of 31 developing counties in Asia, Latin America, and Africa for the period of 1970-2000 They ... Singapore, Indonesia, Malaysia, Thailand, and the Philippines, this paper tests the causal relationship between the two variables of GDP growth and FDI inflow D...
Ngày tải lên: 14/05/2015, 14:22
Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf
... dedicated to well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of “positive ... journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over...
Ngày tải lên: 21/06/2014, 06:20
báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx
... ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTAT...
Ngày tải lên: 12/08/2014, 03:21
The benefits and limitations of a genre - based approach to teaching writing to grade 10 students in Tan Trao high schoool, Tuyen Quang province
... Benefits of G.B .A on students writing proficiency 3 5-3 6-3 7 3.1.2 Limitations of G.B .A to teaching writing 3 7-3 8 3.2 Summary 3 8-3 9 CONCLUSION 1 .The benefits and limitations of the genre- based approach ... a genre based approach to teaching writing ? 6-7 1.2.2 Definitions 7-8 1.2.3 Genre- Based Approach (G.B .A) 1.2.4...
Ngày tải lên: 04/08/2015, 09:42
Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt
... understood as relations (job title) or events (acquisitions) 3.3 Statistical training Because we had no existing methods to address financial events or relations, we took this opportunity to develop ... contextual information using text classification methods We also use text classification methods to help users to more quickly focus on an area where interesting transactions exist...
Ngày tải lên: 08/03/2014, 21:20
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx
... relevant to its intrinsic character The real question to be answered in any inquiry into astrology is whether, and to what extent, astrology is signifrcant and of essential value to human beings, ... a minimum of meaning And it is meaning that man needs; and an understanding of man's need for meaning is necessary to any psychology of health and whole' ness Mean...
Ngày tải lên: 29/03/2014, 04:20
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_2 pdf
... fire, and ether; and all thesefrve elementsare inimical to eachother But with the help of, or due to, the soul, all the five elementsare containedand activein the human body,eachone manifesting ... sensitive, and intuitive They incline to wait on circumstances for guidance in solving problems." An understanding of the elements can, as we have seen, contribute to s...
Ngày tải lên: 29/03/2014, 04:20
A systems-based approach to assessing leadership styles in engineers
... Text Mining Text mining is an “area within data mining that focuses on data from textual sources” (Feldman, 2003; Ye, 2003) Text mining is a large subfield of data mining It is an area that has developed ... research data are compared to the leadership skills needed that industry communicates in trade journals This comparison is determined using a subjective and approximate reasoning...
Ngày tải lên: 01/06/2014, 13:57
Báo cáo hóa học: " Research Article A Dual Decomposition Approach to Partial Crosstalk Cancelation in a Multiuser DMT-xDSL Environment" docx
... the average capacity increase for allocating less or equal crosstalk cancellation taps than rs is set to zero, (ii) the average capacity increase for allocating more crosstalk cancellation taps ... the average capacity increases per allocated crosstalk cancellation tap For each of K tones the capacity increase has to be calculated for all N − crosstalk cancellation configurations...
Ngày tải lên: 22/06/2014, 20:20
Chemical drug assisted gene transfer a sensible approach to improve transgene expression in the central nervous system
... these above studies indicate a novel approach to use HDAC inhibitors to enhance baculovirus-mediated gene therapy by increasing the expression of the transgene In addition, with their intrinsic anti-tumor ... CHEMICAL DRUG- ASSISTED GENE TRANSFER: A SENSIBLE APPROACH TO IMPROVE TRANSGENE EXPRESSION IN THE CENTRAL NERVOUS SYSTEM GUO HAIYAN (B...
Ngày tải lên: 12/09/2015, 10:15
A chemical genetics approach to identify targets essential for the viability of mycobacteria
... A CHEMICAL GENETICS APPROACH TO IDENTIFY TARGETS ESSENTIAL FOR THE VIABILITY OF MYCOBACTERIA STEPHEN HSUEH-JENG LU (B.Sc (Hons.), University of Auckland) A THESIS SUBMITTED FOR THE DEGREE OF ... eradicate both populations The only feasible way to elucidate such a novel target is to use a forward chemical genetics approach Forward chemical...
Ngày tải lên: 15/09/2015, 22:51
Direct and indirect cholinergic septo hippocampal pathways cooperate to structure spiking activity in the hippocampus
... network activity by GABAergic MSvDB neurons 84 4.6 Synergy of direct and indirect cholinergic septo- hippocampal pathways for coordination of spiking activity in area CA3 of the hippocampus ... network activity are mediated via the direct or indirect pathway, and how these pathways might act together in order to structure hippocampal firing pattern...
Ngày tải lên: 26/11/2015, 10:11