exploring a uml profile approach to modeling web services in healthcare

... types of financial transactions they are most related to Paragraphs that did not fall into a category of interest were classified as “other” The annotated paragraphs were divided into random 4x4 ... leading us to investigate visual ways to define queries that go beyond the paragraph and span many texts over many years Finally, we are hoping to conduct user studies to validate our fundamental ... users indicate whether the paragraph is to be treated as a positive or a negative example of the category they are elaborating In our preliminary studies, we were able to achieve the peak performance...

Ngày tải lên: 08/03/2014, 21:20

... Text Mining Text mining is an “area within data mining that focuses on data from textual sources” (Feldman, 2003; Ye, 2003) Text mining is a large subfield of data mining It is an area that has developed ... stated that the objective of text mining is to “determine the underlying information on which the data mining operations are applied” Text Mining Approaches There are three major approaches to ... research data are compared to the leadership skills needed that industry communicates in trade journals This comparison is determined using a subjective and approximate reasoning approach called...

Ngày tải lên: 01/06/2014, 13:57

... the average capacity increase for allocating less or equal crosstalk cancellation taps than rs is set to zero, (ii) the average capacity increase for allocating more crosstalk cancellation taps ... the average capacity increases per allocated crosstalk cancellation tap For each of K tones the capacity increase has to be calculated for all N − crosstalk cancellation configurations To be able ... that in each iteration of the algorithm a minimum of and a maximum of N − crosstalk cancellation taps are allocated Because of this varying granularity, the crosstalk cancellation tap constraint...

Ngày tải lên: 22/06/2014, 20:20

... genome ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA CCTCGATTTTATTTTCTAATTTCTTCATATTGGCAAGTGCATAACTTTGCTTCCTCTCTGT -CTCGTTTTTTTG -TCTCTAAGATTTCCATTGCATTTCGAGGTAGC ... -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA...

Ngày tải lên: 12/08/2014, 03:21

... separated into two individual trachybasalt flows Tirinkatar-1 and Tirinkatar-2, and the Ashtarak lava flow Tirinkatar-1 and Ashtarak each have volumes ~0.5 km3 The largest volume flank lava flows are ... central portion of the lava flow simulation area) comprising lava flows from Shamiram, Atomakhumb, Dashtakar, Blrashark, and Karmratar volcanoes The ANPP site (black box) is located on the Shamiram ... on the Shamiram Plateau In addition, large-volume lava flows are found on the flanks of Aragats volcano, a 70-km-diameter basalt-trachyandesite to trachydacite volcano located immediately north...

Ngày tải lên: 21/06/2014, 19:20

... Books One Particular Computer Book Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab $24.95 ... Create a clear visual hierarchy One of the best ways to make a page easy to grasp in a hurry is to make sure that the appearance of the things on the page—all of the visual cues—clearly and accurately ... with a site tend to blame themselves and not the site The actual Average User is kept in a hermetically sealed vault at the International Bureau of Standards in Geneva We’ll get around to talking...

Ngày tải lên: 27/06/2014, 00:20

... obvious flaws, you’re reading the wrong book Designing, building, and maintaining a great Web site isn’t easy It’s like golf: a handful of ways to get the ball in the hole, a million ways not to Anyone ... Publishing Berkeley, California USA Don’t Make Me Think!: A Common Sense Approach to Web Usability, Second Edition Don’t Make Me Think!: A Common Sense Approach to Web U Prepared for dougbolin@mac.com, ... software and hardware products described in it Trademarks Throughout this book, trademarks are used Rather than put a trademark symbol in every occurrence of a trademarked name, we state that we are...

Ngày tải lên: 14/08/2014, 10:22

... with a site tend to blame themselves and not the site The actual Average User is kept in a hermetically sealed vault at the International Bureau of Standards in Geneva We’ll get around to talking ... he’s saying is “blah blah GINGER blah blah blah blah GINGER blah blah blah.” What we see when we look at a Web page depends on what we have in mind, but it’s usually just a fraction of what’s ... reproduction and/or distribution are strictly prohibited and violate applicable laws All rights reserved c h a pt e r Things that make us think All kinds of things on a Web page can make us stop and think...

Ngày tải lên: 14/08/2014, 10:22

... Books One Particular Computer Book Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab Blab $24.95 ... Questions—“Animal, vegetable, or mineral?”—is a wonderful example of a mindless choice As long as you accept the premise that anything that’s not a plant or an animal— including things as diverse as pianos, ... can actually hear a tiny voice in the back of your head saying, “Blah blah blah blah blah….” A lot of happy talk is the kind of self-congratulatory promotional writing that you find in badly written...

Ngày tải lên: 14/08/2014, 10:22

... Eugene Sakall in Budapest in 1884 Ironically, most of the character actors who played the Nazi-hating denizens of Rick’s Café were actually famous European stage and screen actors who landed in Hollywood ... have the attributes we would expect to see in a brand logo or the sign outside a store: a distinctive typeface, and a graphic that’s recognizable at any size from a button to a billboard .on Web ... link that takes me to the site’s Home page Having a Home button in sight at all times offers reassurance that no matter how lost I may get, I can always start over, like pressing a Reset button...

Ngày tải lên: 14/08/2014, 10:22

... the Web s inherent “lost in space” feeling is by showing me where I am in the scheme of things, the same way that a “You are here” indicator does on the map in a shopping mall—or a National Park ... people can overlook button bars at the top of a Web page.15 But because tabs are so visually distinctive, they’re hard to overlook And because they’re hard to mistake for anything but navigation, ... think of Amazon as primarily a bookstore and hate having to click twice to get to the Books section As usual, the interface problem is just a reflection of a deeper—and harder to solve—dilemma...

Ngày tải lên: 14/08/2014, 10:22

... confuse a tagline with a motto, like “We bring good things to life,” “You’re in good hands,” or To protect and to serve.” A motto expresses a guiding principle, a goal, or an ideal, but a tagline ... expect to see an ad in this space and are likely to ignore it [ 101 ] Don’t Make Me Think!: A Common Sense Approach to Web Usability, Second Edition Don’t Make Me Think!: A Common Sense Approach to ... interest in getting the main point across [ 99 ] Don’t Make Me Think!: A Common Sense Approach to Web Usability, Second Edition Don’t Make Me Think!: A Common Sense Approach to Web U Prepared for...

Ngày tải lên: 14/08/2014, 11:20

... about choosing a toaster.(There was a prominent link to the Dualit, but it was only one of nine featured toasters in three categories: Quality, Style, and Value.) Overall, the Home page message ... Macromedia’s tool for creating animated and interactive user interfaces, not flash (lowercase), the arbitrary use of whiz-bang features to make a site more interesting [ 128 ] Don’t Make Me Think!: A Common ... of always doing a live user test at my workshops so that people can see that it’s very easy to and it always produces an abundance of valuable insights I ask for a volunteer and have him try to...

Ngày tải lên: 14/08/2014, 11:20

... reasonably patient human being ADVANCE PLANNING Tests have to be scheduled weeks in advance to reserve a usability lab and allow time for recruiting Tests can be done almost any time, with little advance ... Approach to Web Usability, Second Edition Don’t Make Me Think!: A Common Sense Approach to Web U Prepared for dougbolin@mac.com, Douglas Bolin © 2006 Steve Krug This download file is made available ... on a networked PC, eliminating the need for a camcorder [ 143 ] Don’t Make Me Think!: A Common Sense Approach to Web Usability, Second Edition Don’t Make Me Think!: A Common Sense Approach to Web...

Ngày tải lên: 14/08/2014, 11:20

... solution is to take something (or things) away that are obscuring the meaning, rather than adding yet another distraction > Take “new feature” requests with a grain of salt People will often say, “I’d ... done, a cat floats by with buttered toast strapped to its back Don’t Make Me Think!: A Common Sense Approach to Web Usability, Second Edition Don’t Make Me Think!: A Common Sense Approach to Web U ... actually needs help accessing the Web They’re willing to write it off as the kind of exaggeration that people make when they’re advocating for a worthy cause, but there’s also a natural inclination...

Ngày tải lên: 14/08/2014, 11:20

... Whitehouse, Allison Cecil (if you need a book designed, find her!), Paul Shakespear, Barbara Flanagan and Roger Black—they all graciously agreed to help again Once again Harry and Melanie have put ... grace, and (b) displaying talent equal to her patience As with Karen and Barbara, anything that strikes you as a design flaw is almost certainly something she did only because I twisted her arm ... extraordinary decency are not incompatible, which enabled me to be comfortable working as a consultant John also dragged me kicking and screaming into professional adulthood at no small personal...

Ngày tải lên: 14/08/2014, 11:20

... engineering For undergraduate programs looking to transition away from the traditional mathematical-based approach to a more applied, hands-on approach, this text will be an invaluable aid.’ Charles ... right angles to the main sail of a windmill, thus always keeping the main windmill drive facing into the wind It was not until the Industrial Revolution, particularly in England, that feedback ... part was documented by using wiring diagrams These wiring diagrams quickly became outdated, as changes were made to the analog board that were not always added to the wiring diagram (human nature)...

Ngày tải lên: 01/01/2014, 17:44

... Identifying what to measure and what to with the data is vital because this information offers a key starting point for leaders and coalitions that are interested in moving communities forward in adopting ... health and in the practice of health care Health care practitioners collect data on an individual patient by taking a medical history and conducting a physical exam, whereas public health practitioners ... visual representation in both graphic and table form x A Public Health Approach to Children’s Mental Health: A Conceptual Framework FORWARD In chapter 6, leaders will find practical information about...

Ngày tải lên: 12/02/2014, 12:20

... as training tools and as useful tools to energize and relax participants They are explained within the module when they are to be used TRAINING MATERIALS AND TOOLS Training materials are a resource ... undergone basic training in the clientcentered approach The trainers should be experienced in encouraging and motivating trainees to participate fully in the training in order to take away the most ... Training material 1.3: Reproductive health 175 Training material 1.4: Young-old lady picture 176 Training material 2.1: Self-awareness 178 Training material 2.2: Jo-Hari window 179 Training material...

Ngày tải lên: 13/02/2014, 10:20