RECRUITING AND RETAINING GENERATION Y – A NEW WORKFORCE

RECRUITING AND RETAINING GENERATION Y – A NEW WORKFORCE

RECRUITING AND RETAINING GENERATION Y – A NEW WORKFORCE

... necessary Another reason is that many of the articles written on Generation Y are not written by Generation Y and may thus by its very nature be biased 14 Recruiting and Retaining Generation Y – A New ... understanding of who they are and what their priorities are Bloom’s Pyramid and the Analytical Approach ensure that explanations and conclusions are based o...
Ngày tải lên : 11/12/2016, 11:09
  • 109
  • 588
  • 0
Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

... Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities Alessandro Clivio, Giorgia Nicolini, Eugenio Vanetti, Antonella Fogliata, ... a laser-based system (LaserGuard) Optional Image-guided patient repositioning was facilitated through 2D-2D MV image matching (Portal Vision Advance...
Ngày tải lên : 09/08/2014, 09:21
  • 29
  • 344
  • 0
Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps

Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps

... hospital's database This database contains all physician's reports, patient baseline data, routine laboratory results, pharmacology data, costs per R446 patient and day of specific medications ... plasma measurements of IL-8 and G-CSF and tracheal aspirate levels of G-CSF, employing a new laboratory method that allows simultaneous determination of parameters from 50...
Ngày tải lên : 12/08/2014, 20:20
  • 8
  • 407
  • 0
Báo cáo y học: " Scaling, growth and cyclicity in biology: a new computational approach" ppsx

Báo cáo y học: " Scaling, growth and cyclicity in biology: a new computational approach" ppsx

... (nowadays an auxological standard), which suggests that the human growth rate exhibits three maxima: one intrauterine, a second one around the 6-th year and a third one other around the 16th year ... balance interpretation, with γ1yp representing the input energy (through a fractal branched network), γ 2y the metabolism and y the asymptotically vanishing growth In fact all...
Ngày tải lên : 13/08/2014, 16:21
  • 7
  • 229
  • 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

... article as: Hermenau et al.: Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional ... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphan...
Ngày tải lên : 13/08/2014, 18:22
  • 9
  • 405
  • 0
Báo cáo y học: " Adolescent girls’ and parents’ views on recruiting and retaining girls into an after-school dance intervention: implications for extra-curricular physical activity provision" ppsx

Báo cáo y học: " Adolescent girls’ and parents’ views on recruiting and retaining girls into an after-school dance intervention: implications for extra-curricular physical activity provision" ppsx

... retaining girls into an after-school dance intervention: implications for extra-curricular physical activity provision International Journal of Behavioral Nutrition and Physical Activity 2011 8:91 ... increase adolescent girls physical activity Systematic reviews of youth physical activity interventions or obesity prevention interventions with a stro...
Ngày tải lên : 14/08/2014, 08:20
  • 9
  • 367
  • 0
Food and health in Europe: a new basis for action pdf

Food and health in Europe: a new basis for action pdf

... health in Europe: a new basis for action Summary WHO Library Cataloguing in Publication Data Food and health in Europe : a new basis for action ; summary 1.Nutrition 2 .Food supply 3 .Food contamination ... private and public institutions In Finland, for example, mass catering provides an excellent means of influencing food intake, since on averag...
Ngày tải lên : 16/03/2014, 14:20
  • 38
  • 334
  • 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

... between archaea and bacteria from genome sequence of Thermotoga maritima Nature 399, 323–329 Lim D & Strynadka A (2002) Structural basis for the b-lactam resistance of PBP 2a from methicillin-resistant ... triad, consisting of a serine in a New thermostable esterase from Thermotoga maritima GXSXG pentapeptide, an acidic aspartate, and a histidine resid...
Ngày tải lên : 23/03/2014, 09:20
  • 11
  • 460
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...
Ngày tải lên : 23/03/2014, 17:22
  • 7
  • 478
  • 0
Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx

Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx

... drawn for the combination of ADP + NAD for ADH, whereas there was a slight increase in inhibition of ADH by the combination of ATP + NAD The combinations ATP + NADH and ADP + NADH had a severe inhibitory ... revealed that LDH and ADH of L lactis ATCC 19435 are inhibited by all inhibitors studied in a different manner than GAPDH Inhibition of LDH...
Ngày tải lên : 29/03/2014, 08:20
  • 10
  • 503
  • 0
Báo cáo hóa học: " Strong convergence theorems for equilibrium problems and fixed point problems: A new iterative method, some comments and applications" pptx

Báo cáo hóa học: " Strong convergence theorems for equilibrium problems and fixed point problems: A new iterative method, some comments and applications" pptx

... Strong convergence theorems for equilibrium problems and fixed point problems: A new iterative method, some comments and applications Fixed Point Theory and Applications 2011 2011:33 Submit your manuscript ... Shang, MJ, Qin, XL: An iterative method of solution for equilibrium and optimization problems Nonlinear Anal 69, 2709–2719 (2008) doi:1...
Ngày tải lên : 21/06/2014, 01:20
  • 15
  • 427
  • 0
báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

... FLS-F, 5’TAAGATTTGGCCTCCTCCTG-3’ and FLS-R, 5’ACCAAGCCCAAGTGATAAGC-3’; F3H-F, 5’AGTGGTGAATTCGAATAGCAGTAG-3’ and F3H-R, 5’-TTTCCTCCTGTACATTTCTGCAA-3’; F3’H-F, 5’GAGGAGTTCAAGTTAATGGTGGT-3’ and F3’H-R, ... to make the primer 75ALerevECO (GGAATTCTCAGCAACGATAAACGTCCAAAGATAG) with an additional EcoRI site for the 3’ end of the gene The 5’ end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGA...
Ngày tải lên : 12/08/2014, 03:21
  • 12
  • 433
  • 0

Xem thêm