... DDL and Security (ADOX) extends the ADO objects and programming model with objects for schema creation and modification, and for security ADOX is used to programmatically access and manipulate ... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat.Create(connectString); } finally { cat = null; } } Discussion ADO ... in a database You can use ADOX from NET through COM interop to create a new Microsoft Access database Use the Create( ) method of the ADOX.Catalog object, passing a connection string for the new...
Ngày tải lên: 24/12/2013, 05:15
... executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement in a similar way To drop the database ... Oracle databases and other databases is similar to that shown for SQL Server although the DDL syntax for each database varies slightly because of differences in database server capabilities and ... statements generally require DBA permissions to execute Database Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database objects are...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu STRENGTHEN CONFIDENCE AND WORK TOGETHER FOR A NEW ROUND OF WORLD ECONOMIC GROWTH doc
Ngày tải lên: 21/02/2014, 01:20
Food and health in Europe: a new basis for action pdf
... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... Greece Malta Italy Spain Portugal Israel France Switzerland Netherlands Germany United Kingdom Austria Belgium Sweden Denmark Norway Finland Yugoslavia Bulgaria Hungary Romania Slovakia Czech ... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt
... Coomassie Brilliant Blue (A) and the other was stained for activity using a- naphtyl acetate after renaturation (B) Lane M relative molecular mass standards; lane 1, cell free extract; lane 2, heat-stable ... 5¢-CA FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS M Levisson et al GTCACCTGGTAGTTACTGCCGCCGAAG-3¢, 5¢-CGAC GATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAAGTTATTGAGATCGTCG-3¢, ... Quickchange (Stratagene) site-directed mutagenesis with the following primers 5¢-GT GCTGGGACACGCCCTCGGTGCGATGC-3¢ and 5¢-GC ATCGCACCGAGGGCGTGTCCCAGCAC-3¢, 5¢-GATCT TCGGCGGCAGAAACTACCAGGTGACTG-3¢ and...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... Romanowska, A. , Gamian, A. , Witkowska, D., Katzenellenbogen, E & Romanowska, E (1994) Serological and structural features of Hafnia alvei lipopolysaccharides containing D-3hydroxybutyric acid ... Fuc and 3-substituted Rha in the molar ratio : These data suggest that the OPS-I and OPS-II have an identical branched tetrasaccharide repeating unit It consists of the main chain containing...
Ngày tải lên: 23/03/2014, 17:22
Food and health in Europe: a new basis for action pptx
... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... both the total quantity eaten and the variety and choice have changed remarkably over the last 50 years Similar changes and differences apply to the availability of milk fat and fish (according...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx
... the lactococcal dehydrogenases and ADH of yeast and horse liver as a function of the ATP and ADP pool Criterion for all data points chosen: [ATP] > [ADP] (A) Dehydrogenases from Lactococcus lactis ... 6-phosphate dehydrogenase by adenosine 5Â-triphosphate Proc Natl Acad Sci USA 56, 15431547 Nakamura M, Fujiwara A, Yasumasu I, Okinaga S & Arai K (1982) Regulation of glucose metabolism by adenine ... different manner than GAPDH Inhibition of LDH and ADH is competitive for ATP, ADP and AMP, whereas inhibition of GAPDH by ATP, ADP and AMP appeared to be mixed However, the high dissociation constants...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo hóa học: " Strong convergence theorems for equilibrium problems and fixed point problems: A new iterative method, some comments and applications" pptx
... Republic of China Author details Department of Mathematics, Honghe University, Yunnan, 661100, China 2Department of Mathematics, National Kaohsiung Normal University, Kaohsiung 824, Taiwan Authors’ ... YF, Shang, MJ, Qin, XL: An iterative method of solution for equilibrium and optimization problems Nonlinear Anal 69, 2709–2719 (2008) doi:10.1016/j.na.2007.08.045 Tada, A, Takahashi, W: Weak and ... equilibrium problems and fixed point problems: A new iterative method, some comments and applications Fixed Point Theory and Applications 2011 2011:33 Submit your manuscript to a journal and benefit from:...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc
... contribution AF and LC coordinated the study Data acquisition and data analysis were done by AC, EV, GN, AF The manuscript was prepared by LC and GN All authors read and approved the final manuscript ... for AAA can be found in Fogliata et al [6] In summary, the AAA configuration phase consisted in the optimisation of parameters and calculation kernels against the measured beam data The optimisation ... for beam characterisation and modelling into the treatment planning system, periodic quality assurance tests and RapidArc operations In all areas, UNIQUE resulted meeting specifications and having...
Ngày tải lên: 09/08/2014, 09:21
báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf
... available); PAL5-F, 5’TTTCTCCATTACAAATCAAACCA-3’ and PAL5-R, 5’-TTCACTTCATCCAAATGACTCC-3’, CHS2 LOC778295 (7794); DFR LOC544150 (7795); FLS-F, 5’TAAGATTTGGCCTCCTCCTG-3’ and FLS-R, 5’ACCAAGCCCAAGTGATAAGC-3’; ... to make the primer 75ALerevECO (GGAATTCTCAGCAACGATAAACGTCCAAAGATAG) with an additional EcoRI site for the 3’ end of the gene The 5’ end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGAGTTATTT), ... 5’ACCAAGCCCAAGTGATAAGC-3’; F3H-F, 5’AGTGGTGAATTCGAATAGCAGTAG-3’ and F3H-R, 5’-TTTCCTCCTGTACATTTCTGCAA-3’; F3’H-F, 5’GAGGAGTTCAAGTTAATGGTGGT-3’ and F3’H-R, 5’-ACTCGCTTTTCCTTGTGTTCTT-3’; ANT1 (7793); JAF13-F,...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps
... visual-analogue scales (range 0–100%) This documentation is again mandatory and must be marked on the laboratory form (Fig 1) In the intervention arm, blood or tracheal aspirate specimens are analyzed ... measurements of IL-8 and G-CSF and tracheal aspirate levels of G-CSF, employing a new laboratory method that allows simultaneous determination of parameters from 50 µl blood or tracheal aspirate ... Clinical data record form A trained study nurse collects all relevant clinical data for the day before and until days after collection of blood and/ or form tracheal aspirate for microbiological examination...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: " Scaling, growth and cyclicity in biology: a new computational approach" ppsx
... numerical tools and carried out the numerical analysis and the third CG has suggested and analyzed the applicative context of the paper Acknowledgements We wish to acknowledge the support of a Lagrange ... dimensionality and both input energy and metabolism are proportional to y In U2, as we have seen, the energy input term has a fractal dimensionality In U3, one more term with a fractal exponent, again ... al suggest a dynamical evolution of p in the transition from an avascular phase to an angiogenetic stage in tumors [13] Equation (7) may have (as in Refs [1] to [6]) a very simple energy balance...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt
... 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets were basically identical for both assessments ... Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system Child and Adolescent ... at home and school in Tanzania [20] To date no prevalence rates for Tanzania are available [20], but Straus [17] reported that more than two thirds of Tanzanian students did not strongly disagree...
Ngày tải lên: 13/08/2014, 18:22
mallaby - more money than god; hedge funds and the making of a new elite (2010)
... on his desk and a dictionary mounted on a stand There was a stock-exchange ticker with a glass dome over it, an electromechanical calculating machine that you cranked by hand, and a couch on which ... mortgage crash in 2007, Asness’s firm, AQR Capital Management, was running a remarkable $38 billion and Asness himself personified the new globe-changing finance He was irreverent, impatient, and scarcely ... hedge funds wreaked havoc with exchange-rate policies in Europe and Asia After the East Asian crisis, Malaysia’s prime minister, Mahathir Mohamad, lamented that “all these countries have spent 10...
Ngày tải lên: 01/11/2014, 21:26
Feasibility investigation and combustion enhancement of a new burner functioning with pulverized solid olive waste
... olive cake in new burner at open air have been studied In order to achieve this aim, the olive cake is preliminary prepared, a special burner is fabricated and a new pilot plant is designed and associated ... secondary air mass flow of 40L/min Abu-Qudais and Okasha [5] have realized an important experimental study of the direct combustion of a diesel and olive cake slurry in the form of a jet-blast atomizer ... of biomass have a large similarity Moreover, kinetic parameters during devolatilization step and char oxidation step for different particle size and under inert and oxidative atmosphere are presented...
Ngày tải lên: 09/09/2015, 10:32
Acceptability, safety and contraceptive efficacy of a new single rod subdermal 3 ketodesogestrel implant in singaporean women acceptors
... etonogestrel AE : Adverse Experience ALP : Alkaline phosphatase ALT : Alanine transaminase Apo A- 1 : Apolipoprotein A- 1 Apo B : Apolipoprotein B AST : Aspartate transaminase AUC : Area Under the ... ambitious targets can only be reached by making available a wider choice of safe, acceptable and affordable contraceptives and high-quality family planning services on a voluntary basis (b) Limiting ... CHAPTER VI PAGE A TWO YEAR COMPARATIVE CLINICAL EVALUATION OF IMPLANONTM AND NORPLANT IMPLANTS IN SINGAPOREAN WOMEN : AN OPEN RANDOMISED STUDY (a) (b) (c) (d) (e) CHAPTER VII CHAPTER VIII CHAPTER...
Ngày tải lên: 15/09/2015, 21:09
Sectors and Styles - A New Approach to Outperforming the Market docx
... whom I am proud to call friends and colleagues Many thanks go to Jason and Jane Welsch, Bharath Chandar, Joseph Roccasalvo, George and Andrea Fulop, Emily and Len Brizzi, Gino and Donna Albertario, ... Albertario, Vahan Janjigian, Annette and Clint Welch, Don Horenstein, Mark Wachs, John Mihale, Mark and Roberta Aaronson, Rocco Papandrea, Milan Miletic, Maris Ogg, Ed McDonough, Connie Dambra, Maria Rudic, ... action and economic performance, and the markets’ take on both It is a rich and robust way to analyze all the important aspects of both the real economy (the G and E part) and the financial economy...
Ngày tải lên: 28/06/2014, 21:20
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...
Ngày tải lên: 31/10/2012, 14:59
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...
Ngày tải lên: 10/04/2013, 14:46