The ‘performativity thesis’ and its critics: towards a political ontology of management accounting

... Making an investigation of some semantic and pragmatic features of the adjective Warm in English and its equivalents in Vietnamese - Analyzing meanings of the adjective Warm in particular contexts, ... discover, analyze and contrast Some linguists have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Wa...

Ngày tải lên: 26/11/2013, 13:21

... error bars indicates that the error was too small to appear on the graph The asterisk on the abscissa marks the onset of high-temperature anomaly in August 1998 Hard corals include Scleractinia and ... set at 1°C above the local HotSpot thresholds Because data on solar radiation are not available for the study area during the bleaching event, the HotSpot anoma...

Ngày tải lên: 07/03/2014, 17:20

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... (TOP) At the heart of this organisational drive, was an attempt to engender greater flexibility of operational practices and an enhanced outward management orientation Many managers across the organisation ... effectiveness and transparency also a ected the form and effects of PBTC Accountants had traditionally internalised a professional conception of the need to econ...

Ngày tải lên: 08/04/2014, 12:07

... concerning its standard claims and practices A liberating humanist alternative is at hand and is confidently asserted as providing a more rational and fulfilling way of life Human societies can flourish and ... Spurway, Sandy Stewart, Alexander Broadie, Graeme Auld, Hans Barstad, George Newlands, Paul Heelas, Iain Torrance, Larry Hurtado and Christian Lange I am especially indebt...

Ngày tải lên: 10/06/2014, 21:23

... as well as its orthocenter H (in this case, all of A2 , B2 , C2 coincide with H) Therefore, k is the Jerabek hyperbola Here follow some corollaries of this fact ONE PROPERTY OF THE JERABEK HYPERBOLA ... HYPERBOLA AND ITS COROLLARIES 55 Statement Let P be a point on the Euler line of ABC, A1 B1 C1 be the circumcevian triangle of P , and A2 , B2...

Ngày tải lên: 18/07/2014, 22:48

... observational case series for development of an ankle prosthesis documentation questionnaire and study of its feasibility and face validity Journal of Foot and Ankle Research 2010, 3:4 ... German, French, Spanish and Italian [2] The English and German versions of the IDES ankle series are available under http://www.memdoc.org, the translatio...

Ngày tải lên: 10/08/2014, 21:24

... and its parts in a sub-adult female population of North India Methods The study was conducted in a selected area of Tehsil Kalka, in the District of Panchkula in Haryana state, Northern India ... Estimation of stature from the foot and its segments in a sub-adult female population of North India Kewal Krishan1,*, Tanuj Kanchan2...

Ngày tải lên: 10/08/2014, 21:24

... Ministry of Education authorized and facilitated the study The following played invaluable roles in data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of Education ... 0.0001) Covariance analysis It was necessary to analysis of covariance in order to understand the impact of anxiety, depression, selfesteem and difficulty with studi...

Ngày tải lên: 11/08/2014, 15:22

... RB, Pahuja A, Alleva D, Acosta HM, Martinez C, Ortega A, Lopez A, Araiza-Casillas R, Zlotnik A: Gene array analysis comparison between rat collagen-induced arthritis and human rheumatoid arthritis ... The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challenge Hua Yu1, Chan...

Ngày tải lên: 12/08/2014, 18:20

... Cite this article as: Youngkong et al.: The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions Cost Effectiveness and Resource Allocation 2011 ... questionnaire, an approach that facilitates MDCA, and distributed this among 24 national health policymakers, 55 health professionals, and 163 general populati...

Ngày tải lên: 13/08/2014, 11:22

... Correction: The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions Sitaporn Youngkong1,2,*, Noor Tromp1, and Dereck Chitama1,3 Nijmegen International ... and its usefulness for priority setting across a broad range of health interventions Cost Effectiveness and Resource Allocation, 201...

Ngày tải lên: 13/08/2014, 11:22

... pathways, and then projects to central, basal and basal accessory nuclei of the amygdala [28], as well as to the hippocampus, orbitofrontal cortex, cingulate [29] and via the reticular activating ... periphery, though they are able to indirectly and bilaterally influence sympathetic and parasympathetic preganglionic neurons via the efferent paraventricular pathway [1...

Ngày tải lên: 13/08/2014, 14:20

... VIETNAMESE IDIOMS: A CONTRASTIVE ANALYSIS FROM CULTURAL PERSPECTIVES (NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CH A TỪ HEART VÀ TỪ ĐỒNG NGH A VỚI HEART TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ... containing the word heart and its synonyms in Vietnamese In each language, idioms containing words of human body part possess a remarkable figure Accord...

Ngày tải lên: 02/03/2015, 14:29