Overview of the judicial system in japan (Cơ quan tư pháp Nhật Bản)
... matters as the appointment and dismissal of court officials other than judges are within the purview of the judicial administration of the Supreme Court As for the budget of the courts, the Supreme ... rule-making and judicial administration With the rule-making power, the Supreme Court may establish the rules of judicial procedure, and of matters relatin...
Ngày tải lên: 06/12/2016, 16:24
Ngày tải lên: 26/02/2014, 06:20
... of tax proceeds; to create a credit history for the further development of SMEs through the bank sector; to barrier SMEs for their transition to the shady sector of economics Why not a bank? ... adopted Under these rules incidence of taxation was reduced either on non-bank MFIs or on clients using given them loans Nowadays: Microfinance activity has become more mature The models...
Ngày tải lên: 24/10/2013, 03:15
an overview of the financial system
... An Overview of the Financial System • Primary function of the Financial System is financial Intermediation • The channeling of funds from households, firms and governments who ... shortage of funds (borrowers) • Direct finance vs Indirect finance 2-2 An Overview of the Financial System II 2-3 Structure of Financial Markets I Debt Markets • Short-ter...
Ngày tải lên: 05/01/2014, 16:55
Overview of the Capital Markets in Vietnam and Directions for Development
... reflects the state of Vietnam’s capital markets as of the end of October 2005 The report disseminates the findings of work in progress to encourage the exchange of ideas about development issues The ... regulatory model of the financial markets including the capital markets Thus, the obscure state of the future financial sector structure general...
Ngày tải lên: 21/01/2014, 12:59
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx
... endocannabinoid system, we investigated the presence and regulation of endocannabinoids, cannabinoid receptors and FAAH in immature and mature dendritic cells obtained by stimulation with either the ... min), two fractions were obtained: a top leukocyte band containing mononuclear cells (monocytes and lymphocytes) and a lower band containing polymorphonuclear le...
Ngày tải lên: 22/02/2014, 07:20
AN OVERVIEW OF THE SECURITY CONCERNS IN ENTERPRISE CLOUD COMPUTING pptx
... cost of cloud computing in information security management includes the costs of migrating, implementing, integrating, training, and redesigning Also it includes the cost of training supporting ... Computing in information security management According to Bendandi (2009, p 7) the top security benefits of cloud computing includes: ♦ The security and benefi...
Ngày tải lên: 05/03/2014, 23:20
manual on the application of the haccp system in mycotoxin prevention and control pdf
Ngày tải lên: 17/03/2014, 16:20
Disease of the Respiratory system in Children ppt
... Introduction The disease of respiratory system is one of the most frequent reasons for hospitalization of infants and children Basic knowledge of the development and functions of respiratory ... requirement When the child begins to stand up and walk the diaphram decline gradually to the level of 5th intercostal space (2) Type of respiration In infant → ab...
Ngày tải lên: 22/03/2014, 09:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...
Ngày tải lên: 23/03/2014, 13:20
An Overview of the Computer System pdf
... common types of programs are system software and application software Bringing the Machine to Life – System Software • System software exists primarily for the computer itself, to help the computer ... type of system software is the operating system (OS) All computers require an operating system • The OS tells the computer how to interact with the user an...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Characterization of the serotoninergic system in the C57BL/6 mouse skin potx
... apparatus producing and metabolizing serotonin and N-acetylserotonin in the skin of C57BL/6 mouse We define further some of the factors determining the activity of this apparatus that include anatomical ... isoform of 252 bp was detected in the brain, pituitary, spleen and M3 subline of S91 melanoma, but not in the C57BL/6 mouse skin or the MelA melanocy...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
... practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on the ... X-ray Additional material Additional file Examination Schedule 1: fokus(C) examination of the spinal column The table shows the different stages of examination...
Ngày tải lên: 20/06/2014, 00:20
Overview of the SOE Reform in Vietnam pps
... basis, in the first instance, for the determination of the share structure The basis for determining the value of the enterprise will be the accounting information in the enterprise’s books of account ... (re)training, investing in SOEs where the State is the dominant shareholder, settling overdue debts of insolvent SOEs, repaying the debts of SOEs where...
Ngày tải lên: 06/07/2014, 22:20