... CatD (10 ng) Values are mean ± SD, n ¼ (Insertion: 10 ng CatE and CatD and ng antigenic peptide were incubated on an ELISA plate CatE and CatD antibodies were used for the detection at dilutions ... ⁄ well) Monospesific antibodies were preincubated with different concentrations of CatE or CatD, before standard ELISA ELISA was performed as described in Experimental procedures The incr...
Ngày tải lên: 07/03/2014, 09:20
... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC- 3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted in...
Ngày tải lên: 22/03/2014, 21:20
Team Risk Management: A New Model for Customer- Supplier Relationships doc
... Project Management Team Risk Management Principles 11 Team Risk Management Functions 12 Scenario Comparing Team Risk Management to Risk Management 17 Advantages of Team Risk Management 19 Answers ... Technical Report CMU/SEI-94-SR-005 July 1994 Team Risk Management: A New Model for Customer -Supplier Relationships Ronald P Higuera Audrey J Dorofee Julia A...
Ngày tải lên: 23/03/2014, 23:21
Báo cáo khoa học nông nghiệp " POST HARVEST MANAGEMENT AND NEW APPROACH FOR SUPPLY CHAIN SYSTEM OF CABBAGE AND WATER MELON " doc
... sample for cabbage, and total fruits per total sample for water melon III Result and discussion 3.1 .Supply chain mapping for cabbage and water melon After harvesting, cabbage and water melon are often ... knowledge of stakeholders A new approach for modern supply chain could be proposed to apply for cabbage and water melon to meet marke...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc
... USA, May–June 1999 Estimation of Instantaneous Mean Frequency [10] H K Kwok and D L Jones, “Improved instantaneous frequency estimation using an adaptive short-time Fourier transform,” IEEE Trans ... of adaptive TFDs is based on signal decomposition In practice, no TFD may satisfy all the requirements needed for instantaneous feature extraction and identification for no...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... adherent monocytes using the Pittsburgh Protocol in roller bottle cultures in Generation Generation of phenotypically mature mDC from adherent monocytes using the Pittsburgh Protocol in roller bottle ... flasks Roller bottles Roller bottles Figure static flask of phenotypically mature mDC from adherent monocytes using ITIP in roller bottle culture...
Ngày tải lên: 11/08/2014, 10:23
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGC...
Ngày tải lên: 13/11/2014, 10:46
a decentralized approach for implementing identity management in cloud computing
... 2011, Article No 32, pp - [4] P Angin, B Bhargava, R Ranchal, N Singh, L B Othmane, L Lilien, and M Linderman, “An Entity-Centric Approach for Privacy and Identity Management in Cloud Computing, ” ... selection approach with the data mining technique and the machine learning technique Figure decentralized IdM in cloud computing C Problem area As demonstrated in [5], c...
Ngày tải lên: 31/07/2013, 09:43
Tài liệu Capabilities, Processes, and Performance of Knowledge Management: A Structural Approach pptx
... intangible assets such as knowledge rather than tangible financial assets are a measure of a company’s value Therefore, various attempts to measure organizational performance in knowledge management ... organization; and measuring the value of knowledge assets and/ or impact of knowledge management Knowledge management is largely based on a management theory that ha...
Ngày tải lên: 24/01/2014, 00:20
Case handling: a new paradigm for business process support pot
... free A1 A2 D4 A3 mandatory Skip mandatory R2 mandatory restricted mandatory D1 D2 D3 Fig Abstract example introducing the schema level of the case handling meta model mandatory for A1 , A2 and A3 ... charge of a case based on that case definition may enter a value for D1 when A1 is ready for execution In addition, she may also enter a value for D2 at this instant, wh...
Ngày tải lên: 15/03/2014, 21:20
Performance Management A roadmap for developing, implementing and evaluating performance management systems doc
... standards appear here> Teamwork Below Expectations Meets Expectations Role Model Achieving ... Expectations Meets Expectations Role Model < performance standards appear here> Performance Management 17 Results Assessment ... PRACTICE GUIDELINES Performance Management A roadmap for developing, implementing and evaluating performance management systems Elaine D...
Ngày tải lên: 17/03/2014, 15:20
Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt
... standards for research quality and objectivity Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials Lynn E Davis, Debra Knopman, ... Civilian Radioactive Waste Management OLMS Office of Labor -Management Standards OMB Office of Management and Budget OPIC Overseas Private Investment...
Ngày tải lên: 23/03/2014, 00:20
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
... current paradigm and a proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes ... integration of TB and HIV care and treatment are highly encouraging while at the same time their examples highlight the technical, programmatic, staffing and s...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: " A new approach to geographic routing for location aided cluster based MANETs" pot
... Improved Location aided Cluster based Routing Protocol; LAR: Location Aided Routing; LACBER: Location Aided Cluster Based Energy-efficient Routing; MOBIC: Mobility Metric Based Algorithm; RREP: Routing ... Neighbor table is a conceptual data structure for formation of a cluster whereas Cluster Adjacency Table (CAT) is used for keeping information about...
Ngày tải lên: 21/06/2014, 03:20