Chlorogenic acid composition of instant coffees

... Both transitions to latent and substrate forms were strongly but differently influenced by the amino-acid composition of the shutter region Surprisingly, we found that substitution of Lys335 to ... investigate the importance of the shutter region for the unique types of RCL insertion in PAI-1, we have now undertaken a number of substitutions in...

Ngày tải lên: 22/02/2014, 07:20

... obtained In summary, this study shows that the fatty acid composition of chylomicron remnants in uences their uptake and induction of lipid accumulation in macrophages, with those enriched in ... fatty acid composition of chylomicron remnants affects their uptake by macrophages and induction of excessive lipid accumulation in the c...

Ngày tải lên: 16/03/2014, 12:20

... is in uenced by the fatty acid composition of the particles Phosphorylation of p65–NF-jB plays a critical role in regulating its transcriptional activity To further investigate the effects of the ... accompanied by modulation of in ammatory processes in macrophages, and that the extent of the inhibitory action on the NF-jB pathway depends upon t...

Ngày tải lên: 23/03/2014, 04:20

... polyunsaturated fatty acids * MUFA: monounsaturated fatty acids * TFA: trans fatty acids * tc: traceal 818 Fatty acid composition including trans fatty acids content of selected Vietnamese instant noodles Trans ... abundant fatty acid in all samples; its concentration was from 39% to 42% (total fatty Fatty acid composition including trans...

Ngày tải lên: 28/08/2013, 16:28

... Fatty Acid and Carotenoids in Gac Fruit MATERIALS AND METHODS Fatty Acid Analysis Materials Gac fruit were purchased from two Asian markets (Vinh Phat and Shun Fat) in Sacramento, ... almost half of the weight of the entire fruit Fatty Acid Analysis Data on total FAME content of aril from two gac fruit were collected Total % weight content of FAME in th...

Ngày tải lên: 09/02/2014, 00:08

... with Co2þ as the cofactor [26] The class II Bacillus coagulans XI, on the other hand, isomerizes xylose most efficiently when in the presence of Mn2þ, whereas its activity toward fructose is best ... responsible for the thermostability of Thermus thermophilus isopropylmalate dehydrogenase Biochim Biophys Acta 1545, 174–183 Petsko, G.A (2001) Structural basis of thermosta...

Ngày tải lên: 22/02/2014, 07:20

... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACC...

Ngày tải lên: 12/08/2014, 03:20

... species of oil palm and use an interspecific hybrid for the analysis of QTLs associated with palm oil fatty acid composition This study employed both dominant (AFLP) and co-dominant (RFLP and SSR) ... quality in an interspecific cross of oil palm Pertanika J Trop Agric Sci 2007, 30:31-44 Alrefai R, Berk TG, Rocheford TR: Quantitative trait locus analysis o...

Ngày tải lên: 12/08/2014, 03:21

... quality of life Before the introduction of the therapeutic use of insulin, diet 11 is the main form of treatment of the disease, and dietary measures included the use of traditional medicines which ... IN VITRO AND IN VIVO STUDIES ON THE ANTIDIABETIC AND ANTILIPIDEMIC EFFECTS OF CHLOROGENIC ACID ONG KHANG WEI [BSc Biomedical Science (Hons.)]...

Ngày tải lên: 08/09/2015, 18:22

... Starch Neutralizer lV, a dried aqueous extract of the common bean (Phaseolus vulgaris) Phase had been standardized to a minimum of 3000 AAlU (alpha-amylase inhibiting units), validated by a modified ... substantially inactivate hemagglutinating activity (HA) and trypsin inhibiting activity (TIA) while preserving alpha-amylase inhibiting ability The established product is st...

Ngày tải lên: 31/10/2012, 15:12

... acid structure in Z japonica We found about 30 kinds of fatty acids in the leaves and stems and about 36 kinds of fatty acids in the roots and rhizomes of Z japonica We focused on the fatty acid ... based on the quantity of lipid, the content ratios of all the fatty acids, and the ratio of each fatty acid RESULTS AND DISCUSSION...

Ngày tải lên: 05/09/2013, 10:17

... investigating the relationship between percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and ... relatively higher in mahua biodiesel than that of biodiesel of palm In addition to unsaturation, ignition delay increases with fuel density and iodine value The effect...

Ngày tải lên: 05/09/2013, 15:28

... αphellandrene and β-phellandrene was 5.73 Table The composition of leaf essential oil of Machilus japonica Siebold & Zucc (Lauraceae) fromVietnam Peak Identification α-Thujene α-Pinene Sabinene KI ... areas [9-12] Results and discussion The essential oil was light yellow and the total yield of 1.23% The chemical composition of the leaf essential oils of...

Ngày tải lên: 12/02/2014, 17:20

... part of Yen Thinh commune, part of Hoa Binh commune (of Huu Lung district), part of Huu Le commune (of Van Quang district) and part of Van Linh commune (of Chi Lang district), Lang Son province ... and discussions 3.1 Bird structure composition On the basis of selective inheritance of study findings earlier conducted at Huu Lien Nature Reserve and the find...

Ngày tải lên: 13/02/2014, 12:20

... substitution mutant snake DNases I The thermal stabilities of the wild-type and mutant enzymes of the snakes were examined by measuring the activities remaining after incubation for 40 at various ... mechanism of generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domai...

Ngày tải lên: 20/02/2014, 23:20