A novel algorithm for the reconstruction of an entrance beam fluence from treatment exit patient portal dosimetry images
... permission of the author An Abstract of A Novel Algorithm for the Reconstruction of an Entrance Beam Fluence from Treatment Exit Patient Portal Dosimetry Images by Nicholas N Sperling Submitted to the ... A Dissertation entitled A Novel Algorithm for the Reconstruction of an Entrance Beam Fluence from Treatment Exit...
Ngày tải lên: 29/10/2016, 15:54
... Annals of Mathematics, 167 (2008), 701–766 A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius Abstract In [KSb] we studied the following model for the spread ... movement of all the other particles In the present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths...
Ngày tải lên: 16/02/2014, 06:20
... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...
Ngày tải lên: 05/05/2014, 15:26
a novel method for the synthesis of cao nanoparticle
... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...
Ngày tải lên: 06/05/2014, 08:55
Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt
... that is, guaranteeing that the generated Rayleigh envelopes are exactly corresponding to the desired covariance matrix The model of a Rayleigh fading generator for generating an individual baseband ... FLAT RAYLEIGH FADING ENVELOPES 4.1 Covariance matrix of complex Gaussian random variables with Rayleigh fading envelopes It is known that Rayleigh fading...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo toán học: "A sharp bound for the reconstruction of partitions" ppt
... (r, c), completing the proof of this case and the theorem Acknowledgements I would like to thank the referee for several suggestions which improved the transparency of the proof References [1] ... that the conjugate of a partition λ is the partition λ obtained by flipping the diagram of λ across the NW-SE axis; it follows that λi counts the number of entries of...
Ngày tải lên: 07/08/2014, 15:22
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... of IP-10 in RA synovitis, because most of the leukocytes infiltrating the SF of rheumatoid joints are PMNs PMNs in the RA SF are in an activated state, and produce a variety of other inflammatory ... a potent angiogenic factor, namely vascular endothelial growth factor, was markedly induced by the interaction of FLS with synovial leukocytes via the integrin/ICA...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"
... Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis Jeffrey R Curtis1,#, John W Baddley1,2, Shuo Yang1, ... VARA visits; all other data used for the analysis were from the administrative claims data To test the performance of the effectiveness algorithm...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx
... important role in determining the mutation class of a quiver In [2], the authors prove that the mutation class of an adjacency matrix associated to a triangulation of a bordered surface with marked ... graph has a unique decomposition, so does the original graph the electronic journal of combinatorics 18 (2011), #P91 43 As an application of the al...
Ngày tải lên: 08/08/2014, 14:23
Báo cáo y học: " New technical approach for the repair of an abdominal wall defect after a transverse rectus abdominis myocutaneous flap: a case report" pot
... Figure of Schema the abdominal wall Schema of the abdominal wall (A) The normal abdominal wall (B) Left: postoperative conditions after bilateral TRAMflap Right: abdominal bulge that developed in the ... fact that, in the present patient, there was no typical incisional hernia pathophysiology but rather an abdominal wall defect that had been created delib...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx
... present a systematic approach for the identification of novel, serologically reactive markers of infection (in this case: VZV) The knowledge about the VZV serostatus is extraordinarily important for ... Pinto et al.: A systematic approach for the identification of novel, serologically reactive recombinant VaricellaZoster Virus (VZV) antigens...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc
... as: D’Onofrio and An: A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA Theoretical ... of the initial concept for comparative analysis between the DHD and CHD and and drafted the initial version of the manuscript GA dra...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects telome...
Ngày tải lên: 14/08/2014, 21:20
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... obesity and chronic diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings togeth...
Ngày tải lên: 14/02/2014, 13:20