... IMAGEQUANT software, and depurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressing values as a percentage Reassociation and quantification of ... carried out for each individual atom Data collection and refinement statistics are given in Table Assay of the N-glycosidase activity of ricin A chain variants The...
Ngày tải lên: 19/02/2014, 12:20
... doughnut-shapes on the time-frequency plane Hence, the algorithm constitutes a toroidal waveform structure on the time-frequency plane Figure presents the waveform of the system in timefrequency plane for the ... transmission The figure shows time-frequency regions are occupied by HermiteGaussian functions of orders i = 0, 1, 2, Therefore, linear combinations of the...
Ngày tải lên: 21/06/2014, 16:20
VIETNAM INTERNET NETWORK INFORMATION CENTER REPORT ON VIETNAM INTERNET RESOURCES 2013
... Information Center | http://www.vnnic.vn Copyright by Vietnam Internet Network Information Center | http://www.vnnic.vn REPORT ON VIETNAM INTERNET RESOURCES 2013 REPORT ON VIETNAM INTERNET RESOURCES 2013 ... Internet Network Information Center | http://www.vnnic.vn Copyright by Vietnam Internet Network Information Center | http://www.vnn...
Ngày tải lên: 23/07/2014, 16:14
báo cáo khoa học: "Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin" potx
... F:ctacaatgagctgcgtgtggc R:caggtccagacgcaggatggc p15 DNMT1 R:ggtttgacttcggagtctct DNMT 3A F:cacacagaagcatatccaggagtg R:agtggactgggaaaccaaataccc DNMT3B F:aatgtgaatccagccaggaaaggc R:actggattacactccaggaaccgt F: Forward ... F:gtggggcgccccaggcacca 517 Variable 271 Variable F:tgggggcggcagcgatgag R:aggtgggtgggggtgggaaat 451 56 F:accatcacatctcattttgc 238 56 551 55 190 55 R:ctccttaatgtcacgcacgatttc...
Ngày tải lên: 10/08/2014, 22:21
Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells
... treated CEM /Bcl- 2 cells Indeed, if MnSOD was engaged in blunting mitochondrial O2- increase in antimycin-treated CEM /Bcl- 2 cells due to increased activity in the context of Bcl- 2 overexpression, ... a conformational change in Bcl- 2, exposing its BH3 domain, converting Bcl- 2 from anti-apoptotic to pro-apoptotic (Lin, Kolluri et al 20 04) 1.6 Non-canonical...
Ngày tải lên: 14/09/2015, 08:42
REMOTE CONTROL AND MONITORING SYSTEM VIA SMS AND INTERNET
... PC and controls, control devices remotely We use Yahoo server to connect Center PC to Remote PC Center PC send commands to Remote PC via Yahoo Messenger After receiving command of Center PC, Remote ... (storage and graph) 1.4 Model connection for collecting data from remote sensor using internet Home PC Internet RS232 RS232 Remote PC Remote Center Sensor RS232 Extended...
Ngày tải lên: 25/04/2013, 11:25
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... size of the Internet, let alone to make an estimation of the amount of information that is available on or through it; • The dynamic nature of the information on Internet: information that cannot ... Theory Intelligent Software Agents in Practise Intelligent Software Agents in Practise 3.1 Applications of Intelligent Agents The current app...
Ngày tải lên: 08/10/2012, 15:22
Báo cáo y học: "Clinical Symptoms Associated with Asystolic or Bradycardic Responses on Implantable Loop Recorder Monitoring in Patients with Recurrent Syncope"
... in the research phase In conclusion, chorioretinal involvement, frequently asymptomatic and self-limited, is present in almost 80% of patients with WNV infection associated with neurologic disease ... M, Ben Yahia S, Ladjimi A, et al Chorioretinal involvement in patients with West Nile virus infection Ophthalmology 2004;111:2065-70 Garg S, Jampol LM Systemic and intraocula...
Ngày tải lên: 03/11/2012, 11:17
Báo cáo y học: "Clinical Symptoms Associated with Asystolic or Bradycardic Responses on Implantable Loop Recorder Monitoring in Patients with Recurrent Syncope"
... response on ILR monitoring Group 2= Patients without asystolic or bradycardic response on ILR monitoring Symptoms (Table and Figure 1) Aura or prodrome: Only thirteen percent of patients in group1 ... characteristics of patients with asystolic or bradycardic responses during ILR monitoring (Group 1) are compared with those without asystolic or brad...
Ngày tải lên: 03/11/2012, 11:17
Đề án Khai thác thông tin Marketing qua internet (Gathering Marketing Information via Internet)
... cận nguồn thông tin phục vụ cho kinh doanh marketing qua internet Ứng dụng kỹ tìm kiến thông tin để giúp tìm kiếm thông tin thứ cấp phục vụ cho công tác lập kế hoạch kinh doanh marketing nhiều ... www.vietnammarcom.edu.vn • www.marketingvietnam.net • http://www.marketingpower.com/ H Đánh giá kết học tập môn Thuyết minh cách đánh giá kết học tập Sinh viên thực đề án đán...
Ngày tải lên: 14/01/2013, 11:56
Nghiên cứu xây dựng một trang bán sách trên Internet dựa trên công nghệ Active Server Page (ASP )
... Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ASP CHƯƠNG II MICROSOFT WEB SERVER VÀ CÁC MỨC CÔNG NGHỆ I INTERNET INFORMATION SERVER (IIS) Internet Information Server (IIS) Web server ... tắt ARPA) xây dựng dự án nối kết trung tâm nghiên cứu lớn toàn liên bang , mở đầu bốn sở : Viện nghiên cứu Stadford, Đại học California Nghiên cứu...
Ngày tải lên: 27/04/2013, 08:33
Nghiên cứu xây dựng một trang bán sách trên Internet dựa trên công nghệ Active Server Page (ASP )”.
... 0918.775.368 Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ASP CHƯƠNG II MICROSOFT WEB SERVER VÀ CÁC MỨC CÔNG NGHỆ I INTERNET INFORMATION SERVER (IIS) Internet Information Server (IIS) Web server ... 0918.775.368 Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ASP - Khi có sách nhập vào kho, vào hoá đơn nhập sách...
Ngày tải lên: 27/04/2013, 08:34
Developing Writing Skills in a Foreign Language via the Internet.doc
... acquainted with the configuration of this genre, learners can model their own work in this area of academic writing The Internet The Internet has made many opportunities available to both learners ... keypals, and mailing lists just to name a few And, at our very fingertips are assorted, authentic materials whose access are not limited to either temporal or spatial constraints, fo...
Ngày tải lên: 06/09/2013, 05:10
3G Marketing on the Internet
... get into the “Members Only” section, go to the Maximum Press Web site located at www.maxpress.com and follow the links to the companion Web site for 3G Marketing on the Internet section When ... chapter we look at: • Consumers and the Internet 3G Marketing on the Internet • Evolving Technology • Business and the Internet • Resources for Research Consumers and...
Ngày tải lên: 16/10/2013, 10:15