... Me! Me! Me! Which Inner Self is Running Your Life? by Astra Niedra Would you like to understand yourself better, including why you make the decisions you and have the ... judge wildness then your primary self is probably sensible If you judge selfishness then your primary self is probably generous If you judge flirtatiousness then your primary self is...
Ngày tải lên: 28/06/2014, 00:20
lesson plan 10-caried out by Tran Lan
... 'harrow (v) : - a plot of land (n) ( point at the picture) - 'peasant (n) : a poor farmer - pump(v) : - trans'plant (v) (use words "plant" and "trans-" to explain) the transplanting - Ask sts to listen ... task by asking two sts to report - Listen and give remarks Key: + The events: people got on plane, plane took off, hostesses were just beginning to serve lunch when plane began to shake,...
Ngày tải lên: 06/11/2013, 11:11
Tài liệu Excerpts From Your Word is Your Wand By Florence Scovel Shinn ppt
... Chapter 1: Your Word is Your Wand Man's word is his wand filled with magic and power! Jesus Christ emphasized the power of the word; "By thy words thou shalt be justified and by thy words thou ... waves," to control conditions His word is his wand and he transmutes apparent failure into success He knows his universal supply is endless and immediate and all his need...
Ngày tải lên: 26/01/2014, 15:20
Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx
... +dithiothreitol C Discussion The aims of the present study were to establish whether chloroplastic GAPDH isoforms undergo glutathionylation and thiol oxidation, and to examine the effect of these modifications ... in the case of A4-GAPDH, suggesting that catalytic Cys149 was the target of the redox modification (Fig 10A) Protection by BPGA of the A8B8 isoform cou...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Pleiotropy of leptin receptor signalling is defined by distinct roles of the intracellular tyrosines docx
... of LEPRb, phosphorylation of STAT1, STAT3, STAT5 and the ERK kinases was induced by leptin The weak response of STAT5 to leptin compared to that elicited by GH can be partially explained by the ... activation of STAT5 The results of our mutational analysis are consistent with findings obtained with other cytokine receptors: the position after the phosphotyrosine...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: The mouse Muc5b mucin gene is transcriptionally regulated by thyroid transcription factor-1 (TTF-1) and GATA-6 transcription factors pdf
... study of the regulation of the Muc5b promoter by TTF-1 and GATA factors Using this approach, we aimed to show the transcriptional regulation of Muc5b by these two transcription factors, thereby providing ... these factors in both the human [29] and murine (this report) MUC5B mucin genes, a restricted pattern of MUC5B expression in the respiratory tract [5]...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Thyroid Ca2+/NADPH-dependent H2O2 generation is partially inhibited by propylthiouracil and methimazole ppt
... hand, it is possible that the inhibition of thyroid hormone biosynthesis by MMI in vivo is due to both a direct effect on TPO activity and its ability to scavenge H2O2 In fact, the amount of H2O2 ... NADPH and thus H2O2 generation would be impaired In conclusion, this study shows that MMI, but not PTU, is able to scavenge H2O2 in the micromolar range and that both PT...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... manufacturer GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG ... cystatin A in green and papain in blue Residues in the second binding loop of cystatin A mutated in this work are in red Papain residues involved in interacti...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Rum1, an inhibitor of cyclin-dependent kinase in fission yeast, is negatively regulated by mitogen-activated protein kinase-mediated phosphorylation at Ser and Thr residues pptx
... function of p25rum1 in the cell cycle may be regulated mainly by ubiquitination-based control of protein levels initiated by Cdc2–Cig1-mediated Thr5 8 /Thr6 2 phosphorylation However, Thr1 3 /Ser1 9 phosphorylation ... domain of the protein while the N-terminal portion is a regulatory domain mediating a reduction in activity upon phosphorylation of Thr1 3 /Ser...
Ngày tải lên: 17/03/2014, 23:20
Presentation References The Time Is Now: Invest in Sexual and Reproductive Health for Young People docx
... Investing in Youth for National Development www.prb.org THE TIME IS NOW: INVEST IN SEXUAL AND REPRODUCTIVE HEALTH FOR YOUNG PEOPLE Guttmacher Institute, Facts on the Sexual and Reproductive Health ... Investing in Youth for National Development THE TIME IS NOW: INVEST IN SEXUAL AND REPRODUCTIVE HEALTH FOR YOUNG PEOPLE www.p...
Ngày tải lên: 22/03/2014, 12:20
Báo cáo khoa học: AdipoR2 is transcriptionally regulated by ER stress-inducible ATF3 in HepG2 human hepatocyte cells pdf
... transcription of AdipoR2 under ER stress in the liver In this study, exposure to the ER stress inducer thapsigargin and the accompanying induction of ATF3 were inversely correlated with changes in the ... proteins analyzed in ER stress-induced HepG2 cells determined by western blot Table S2 Densitometric values of proteins analyzed in HepG2 cells by western blo...
Ngày tải lên: 22/03/2014, 21:21
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt
... uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; ... PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, France) Only ....
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khóa học: Fidelity of targeting to chloroplasts is not affected by removal of the phosphorylation site from the transit peptide doc
... SSU transit peptides were identical to those for tobacco SSU transit peptides Alteration of the phosphorylation site did not impede targeting of the passenger GFP to the chloroplasts, nor was there ... from Aequorea victoria [15], and the phosphorylation site was mutated After transformation of the construct into plant cells by particle bombardment, t...
Ngày tải lên: 23/03/2014, 12:20