A NOVEL APPROACH FOR MINING EMERGING PATTERNS IN DATA
Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc
... used instead of 15 and 16 variables by the linear methods Apparently, these input variables contained more information in a nonlinear way than the other 15 or 16 contained in a linear way When a ... relevant input variables Background Hospital information systems in intensive care medicine generate large datasets on a daily basis These rapidly increasing amounts of d...
Ngày tải lên: 13/08/2014, 08:20
a decentralized approach for implementing identity management in cloud computing
... 2011, Article No 32, pp - [4] P Angin, B Bhargava, R Ranchal, N Singh, L B Othmane, L Lilien, and M Linderman, “An Entity-Centric Approach for Privacy and Identity Management in Cloud Computing, ” ... selection approach with the data mining technique and the machine learning technique Figure decentralized IdM in cloud computing C Problem area As demonstrated in [5], c...
Ngày tải lên: 31/07/2013, 09:43
Báo cáo hóa học: " ZSBT: A Novel Algorithm for Tracing DoS Attackers in MANETs" pot
... ZSBT ALGORITHM FOR MANETS Differences between Internet and MANET when tracing a DoS attacker To trace a remote DoS attacker in MANET is an extremely challenging task Two main reasons are as the ... proposed a small worldbased attacker traceback (SWAT) approach to trace DoS attacker in MANET They use traffic patterns matching (TPM) and traffic volume matching (TVM) as matchin...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo y học: "A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data" pot
... as: Yau et al.: A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data Genome Biology 2010 11:R92 Submit your ... Biegel JA, Maris JM: Genomic copy number determination in cancer cells from single nucleotide polymorphism microarrays based on quantitative genotyping...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
... 12(4):314-325 114 Higashimoto Y, Yamagata Y, Taya S, Iwata T, Okada M, Ishiguchi T, Sato H, Itoh H: Systemic inflammation in chronic obstructive pulmonary disease and asthma: Similarities and differences ... molecular fingerprint is analysed, would increase the accuracy of disease diagnosis, aid earlier disease detection, allow for improved clarification of disease subtypes an...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps
... the intergenic sequences Results A two-step procedure for phylogenetic footprinting In this study, we aimed to detect regulatory motifs that have been retained over long periods in evolution; in ... broken up into small conserved parts interrupted by gaps when aligned to the longer Fugu sequence, resulting in an incorrect alignment of the regulatory motifs: previously repor...
Ngày tải lên: 14/08/2014, 16:20
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGC...
Ngày tải lên: 13/11/2014, 10:46
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... CatD (10 ng) Values are mean ± SD, n ¼ (Insertion: 10 ng CatE and CatD and ng antigenic peptide were incubated on an ELISA plate CatE and CatD antibodies were used for the detection at dilutions ... ⁄ well) Monospesific antibodies were preincubated with different concentrations of CatE or CatD, before standard ELISA ELISA was performed as described in Experimental procedures The incr...
Ngày tải lên: 07/03/2014, 09:20
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and B-lymphoid ... by a G1 DNA content of 40.8% 980 PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER Figure FISH preparations of interphase cell...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc
... binding of the C-terminal domain of hirudin and amidase activity in human alpha-thrombin Biochem J 289, 475480 Baglia FA & Walsh PN (1996) A binding site for thrombin in the apple domain of factor ... coagulation factor XI deciency in six Italian patients Haematologica 89, 13321340 Naito K & Fujikawa K (1991) Activation of human blood coagulation factor XI in...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf
... with 10K, 20K and 40K training data 3.4 Training Data The training data includes manually annotated 3625 sentences (approximately 40,000 words) for both supervised HMM and ME model A fixed set ... a reasonable POS tagger when tagged resources are limited References A Dalal, K Nagaraj, U Swant, S Shelke and P Bhattacharyya 2007 Building Feature Rich POS Tagger for Morphologically...
Ngày tải lên: 31/03/2014, 01:20
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx
... Quan, W J Kaiser, and A H Sayed, A spatial sampling scheme based on innovations diffusion in sensor networks,” in Proceedings of the 6th International Symposium on Information Processing in Sensor ... Shapes of the Gaussian and the Laplacian kernels around the origin more classical and universal ones In this paper, without any essential loss of generality, we are primarily...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
... (iv) the totalised values for area Atotal , Stotal , and time Ttotal ; the time based degree of parallelism γt the ranks of all vertices; the density ρ of the system graph These values can be achieved ... hardware-software systems, Ph.D thesis, University of California, Berkeley, Calif, USA, 1995 ´ ´ [13] P Arato, Z A Mann, and A Orb´ n, “Algorithmic aspects of a...
Ngày tải lên: 22/06/2014, 06:20