21093 for during
For, during và while
... For, during while Chúng ta dùng during + danh từ để lúc việc xảy (không phải “trong bao lâu”): During the film during our holiday during the nigh (trong buổi chiếu ... during while thí dụ sau: - We met a lot of interesting people during our holiday 2/3 For, during while (Chúng gặp nhiều người thú vị kỳ nghỉ chúng tôi.) - We met a lot of interesting people while ... rained during the night (Mặt đất ẩm ướt Chắc hẳn đem trời mưa) - I’ll phone you sometime during the afternoon (Tôi gọi điện thoại cho bạn vào lúc buổi chiều nay) During while Chúng ta dùng during...
- 3
- 306
- 0
21096 for during or while
...
- 1
- 210
- 0
Báo cáo y học: "Evaluation of maternal infusion therapy during pregnancy for fetal development"
... prevalence of infusion during the study pregnancy in any CA-groups On the other hand the maternal infusion during the study pregnancy showed 139 a lower occurrence in two CA-groups: hypospadias ... prevalence of maternal infusion in the group of total CAs, and within them, of hypospadias and multiple CAs Thus, we were not able to detect any teratogenic potential of infusion treatment during pregnancy ... dimenhydrinate usage during pregnancy Arch Obstet Gynecol 2005; 271: 113-118 Czeizel AE, Puhó E, Bánhidy F, Ács N Oral pyridoxine during pregnancy Potential protective effect for cardiovascular malformation...
- 6
- 479
- 0
Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt
... E.T., and Holmes, J., 2008, Investigation of organic chemicals potentially responsible for mortality and intersex in fish of the North Fork of the Shenandoah River, Virginia, during spring of 2007: ... liter (pg/L) Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 By David ... showing location of the two sampling sites on the North Fork of the Shenandoah River, Virginia Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the...
- 24
- 865
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... identification and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential ... in A thaliana A D B E C F Fig Maximum activities of enzymes in central carbohydrate metabolism during cold exposure (A C) Vmax values of three invertase isoforms: vInv, nInv and eInv (D) Vmax of ... (1999) Acclimation of Arabid¨ opsis leaves developing at low temperatures Increasing cytoplasmic volume accompanies increased activities of enzymes in the Calvin cycle and in the sucrose-biosynthesis...
- 13
- 707
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... observations of the effects of seasonal temperature acclimation on the properties of purified LDH-A from skeletal muscle of weatherfish Misgurnus fossilis acclimatized to either °C (‘cold’ enzyme) or ... Assemblage of the clones yield the full-length cDNA sequences of at least two distinct LDH-A isoforms, which differ substantially in the coding sequence and length of the 3¢-UTR Therefore, isoform-specific ... adjusted to new functional states [24] To obtain a better understanding of the mechanisms of temperature adaptation in enzymes we studied LDH-A mRNA from the skeletal muscle of weatherfish M fossilis...
- 11
- 662
- 0
Tài liệu Báo cáo Y học: Phosphorylation of initiation factor-2a is required for activation of internal translation initiation during cell differentiation ppt
... differentiation, translation mediated by cellular IRES elements benefits from phosphorylation of eIF2a Supplementary mechanisms for inhibition of global protein synthesis, such as reduced availability of the ... is commonly regulated at the level of eIF2a phosphorylation [4,24], we wished to check the status of eIF2a phosphorylation in cells undergoing differentiation For this purpose, the cells were ... observed for the IRES-less transcript from pLL Reduction of global protein synthesis during differentiation is accompanied by eIF2a phosphorylation The terminal differentiation process is usually accompanied...
- 10
- 409
- 0
Cardiac and Hemodynamic Changes during Carbon Dioxide Pneumoperitoneum for Laparoscopic Gynecologic Surgery in Rajavithi Hospital ppt
... provided with lactated Ringer solution The subjects were supine for induction and emergence from anesthesia, remaining in a flexed lateral decubitus position during laparoscopic intervention None of ... every minutes) for the remaining laparoscopic part of the procedure (measurements obtained every minutes), and after evacuation of the carbon dioxide A p-value of less than 0.05 was accepted for ... Cardiorespiratory data before, during and after CO2 insufflation in an extraperitoneal laparoscopy cohort Mean (SD) / p-value Parameter Before insufflation (base line) First 10 mins insufflation (every...
- 5
- 369
- 1
Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt
... in Man2 addition to GPIs We conclude that human Ybr004cp is the functional equivalent of S cerevisiae Ybr004cp Discussion The majority of the steps in assembly and decoration of the GPI precursor ... protein (Ybr004cp) required for addition of the second mannose to GPI precursors Yeast cells depleted of Ybr004cp exhibit cell wall and morphological abnormalities, are defective in the incorporation ... with 1163 Second mannose addition to GPI precursors A A.-L Fabre et al B Fig ybr004c acts downstream of gpi1 and upstream of smp3 in the GPI biosynthetic pathway (A) A gpi1D ⁄ ybr004cDpGAL-YBR004c...
- 9
- 398
- 0
NUTRIENT ADEQUACY OF EXCLUSIVE BREASTFEEDING FOR THE TERM INFANT DURING THE FIRST SIX MONTHS OF LIFE potx
... the uniform recommendation of exclusive breastfeeding for the first months of life is the lack of understanding of reasons for the marked attrition rates in exclusive breastfeeding, even among ... intentions to exclusively breastfeed for months, 23% of mothers added solids to their infant s diet at 4.5 months; 55% HUMAN-MILK INTAKE DURING EXCLUSIVE BREASTFEEDING IN THE FIRST YEAR OF LIFE Table ... determinants of the duration of exclusive breastfeeding A limitation to promoting exclusive breastfeeding for the first months of life is our lack of understanding of the reasons for the attrition rates...
- 57
- 522
- 0
Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc
... 5¢-GGCTCTAGAATGTGTTCTTTTCAG GTTCCAT-3¢ and the reverse primer 5¢-CCGGAGCTCTT AAGATTGGAGAGCATGCTG-3¢ For ScGrx4, the we used the forward primer 5¢-GCCGGATCCATGACTGTG GTTGAAATAAAAAG-3¢ and the reverse primer 5¢-CCGG AGCTCTTACTGTAGAGCATGTTGGAAATA-3¢ ... specifically targeting human Grx3 sequences were purchased from SigmaAldrich The human Grx3 shRNA1 sequence is 5¢-CCG GGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTC CTTTCATAAAGAGCTTTTTG-3¢ The human Grx3 shRNA2 ... 5¢-CATGGTGCCCAGAAATGAAC-3¢; probe (Grx3-79T): 5¢-CTACTGCGCCTCAAAACCAAGTCACT CCT-3¢ The housekeeping gene cyclophilin was used to normalize the gene expression data Mammalian monothiol glutaredoxin...
- 15
- 314
- 0
Báo cáo khoa học: Directed evolution of formate dehydrogenase from Candida boidinii for improved stability during entrapment in polyacrylamide ppt
... were introduced during the first step of evolution Stability of mutant FDHs in PAA Finally, the performance of the FDH variants after entrapment in PAA was investigated by measuring the activity in ... temperature of 30 °C for 30 The reaction was started by injecting 100 lmol of formate into the vial and stopped after 60 by injecting mL of HCl (1 molÆL)1) After another 30 of incubation, a gas sample of ... employing gel formation itself was therefore developed Effects of PAA building blocks on wild-type FDH Formation of PAA gels involves the cross-linking of acrylamide and bis-acrylamide monomers in...
- 8
- 377
- 0
Guidelines for Use of Personal Protective Equipment by Law Enforcement Personnel During A Terrorist Chemical Agent Incident potx
... GUIDELINES FOR MASS USE OF PERSONAL PROTECTIVE EQUIPMENT BY LAW ENFORCEMENT PERSONNEL DURING A TERRORIST CHEMICAL AGENT INCIDENT 1.0 INTRODUCTION AND BACKGROUND The challenges facing law enforcement officers ... actual chemical response MIST does not place people at risk of exposure to chemical agents because a chemical simulant vapor is used in place of actual agent vapors The simulants used duplicate actual ... in a Highly Lethal and a Saturated Concentration of Chemical Warfare Nerve Agent Vapors Stay-Time Guidance for Various Personal Protective Ensembles in a Perimeter Concentration of Chemical Warfare...
- 101
- 440
- 0
Cách sử dụng "During", "For" và "While" ppt
... giới từ during, for, while thường dùng với cụm từ thời gian Chúng ta xem khác sử dụng during, for, while Cách sử dụng "during" During giới từ dùng trước a danh từ (during + noun) để nói điều ... "Nobody spoke during the presentation." "We get plenty of snow here during the winter." Cách sử dụng while Sử dụng while ta dùng để nói hai việc xảy lúc Độ dài thời gian không quan trọng Hãy nhớ ... rang while I was watching TV." "I met him while we were studying in the library." Cách sử dụng for For giới từ sử dụng để nói khoảng thời gian điều xảy Ví dụ: "Simon has been sleeping for hours."...
- 5
- 628
- 3
Từ khóa: still yet already since for duringtips for stress management during exams10 tips for managing stress during examscách dùng during và fortips for nerves during public speakingwhat nerve is responsible for increasing the heart rate during exercisechemotherapy for breast cancer during pregnancyemerging therapeutic options for breast cancer chemotherapy during pregnancyfood for breast cancer patients during chemotherapywhat is the hormone responsible for increasing blood glucose levels during the starvation state1994 94 cited by vandergrift 1999 176 the performance checklist for listening comprehension process is to be used during learner apos s listening processsales and purchases on credit take place at prices that compensate for the expected loss of purchasing power during the credit period even if the period is short orthe following details shall be provided for each significant impairment recognised or reversed during the reporting period for an item of property plant and equipmentthe following details shall be provided for each significant impairment recognised or reversed during the reporting period for an intangible assetfor share options exercised during the reporting period the weighted average share price at the exercise date shall be disclosed the weighted average share price during the period may also be statedBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ