Topic requirements and effects
... would help to improve the economic situation and would render the city a more important center for the region Yet, this might also have certain negative effects on the community Older people, being ... traffic, the abuse of alcohol or violence and crime To sum up, it seems important to me to consider which type of university could profit form the local environment and to ensure that i...
Ngày tải lên: 29/08/2016, 22:04
... inadequacy on the part of the patients foreseeing failure in achieving their social aims The second approach by contrast, de-emphasizes the formal/structural aspects of the proper performance of social ... at the end of treatment and at 1-year follow-up The combination of psychological treatments and medication was on the whole disappointing: in the stu...
Ngày tải lên: 01/11/2013, 08:20
... States Army under Contract No DASW0 1-0 1-C-0003 Library of Congress Cataloging -in- Publication Data Implementation of the asthma practice guideline in the Army Medical Department : evaluation of process ... MG31 9-1 .1 Command in December 1999 Army- wide implementation began in spring 2000 for the low back pain guideline, in Fall 2000 for the...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Increasing Participation in Army Continuing Education - eArmyU and Effects of Possible Program Changes pptx
... Congress Cataloging -in- Publication Data Increasing participation in Army continuing education : eArmyU and effects of possible program changes / Bruce R Orvis [et al.] p cm “MG-293.” Includes bibliographical ... enrolling in eArmyU are not planning to separate from the Army in the near term 11 12 Increasing Participation in Army Continuing Educat...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Grid Database Access and Integration: Requirements and Functionalities pptx
... different requirements and potential functionalities of Grid Database Services, and (ii) the relationship between database and other services supported within The Grid Requirements for Grid Database ... an overview of requirements and functionalities for Grid Database Access and Integration Services It is not claimed that the requirements are complete N...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên: 20/02/2014, 01:20
Credit Growth and the Effectiveness of Reserve Requirements and Other Macroprudential Instruments in Latin America pdf
... borrowing.2 A summary of the recent use of macroprudential measures in Latin America is reported in Table Despite their increasing use, the effectiveness of macroprudential policies in leaning against ... measure the changes in RRs and in other macroprudential policies Our findings indicate that RRs and other macroprudential policies lead to a moder...
Ngày tải lên: 06/03/2014, 04:21
Nematode Economic Thresholds: Derivation, Requirements, and Theoretical Considerations pptx
... C and D, respectively (Fig 2) producing economic threshold estimates of 22 and 125 for the control practice considered By m a n i p n l a t i o n and consideration of the curves in Figs l and ... ftmctions and economic thresholds are corrected for extraction efficiency so that they can be adapted to other extraction systems CONCLUSIONS Data needed for considerations of econom...
Ngày tải lên: 08/03/2014, 09:20
Key Differences Between National Bank Regulatory Requirements and Federal Savings Association Regulatory Requirements pptx
... Key Differences between National Bank Regulatory Requirements and Federal Savings Association Regulatory Requirements I GENERAL POWERS AND OPERATIONAL REQUIREMENTS Lending/Investment Powers Federal ... applicable to both national banks and federal savings associations: see Appendix A to 12 C.F.R Part 30 (national banks) and Appendix A to 12 C.F.R Par...
Ngày tải lên: 15/03/2014, 10:20
A review of the environmental fate and effects of hazardous substances released from electrical and electronic equipments during recycling: Examples fromChina and India doc
... lessen hazardous emissions from global WEEE, as well as to improve the recovery of valuable substances contained therein Conclusion This review of data on the environmental fate and effects of hazardous ... the Control of Transboundary Movements of Hazardous Wastes and their Disposal Despite the existence of these agreements and conventions, the t...
Ngày tải lên: 23/03/2014, 04:20
OIL AND GAS BONDS - Bonding Requirements and BLM Expenditures to Reclaim Orphaned Wells doc
... 3: Number of Wells and BLM Expenditures to Reclaim Orphaned Wells, by State, Fiscal Years 1988–2009 Page i 11 17 18 GAO-1 0-2 45 Oil and Gas Bonds Table 4: Number of Orphaned Wells, Wells with a ... for any findings and conclusions Page 33 GAO-1 0-2 45 Oil and Gas Bonds Appendix II: Information on BLM Held Oil and Gas Bonds Appendix II: Info...
Ngày tải lên: 29/03/2014, 06:21
SEIGNIORAGE, RESERVE REQUIREMENTS AND BANK SPREADS IN BRAZIL pptx
... deposit and lending rates; direct and indirect taxes explain an additional 30% and the net bank margin the remaining 35% (Banco Central Brasil, 2001) The sharp decline in spreads between 1996 and ... for deposit banks Bank seigniorage revenue (or inflationary revenue) is the increase in non-interest bearing demand deposits (∆DD) minus the increase in non-interest bearing r...
Ngày tải lên: 29/03/2014, 13:20
THE PLANNING OF A CUSTOMER RELATIONSHIP MANAGEMENT PROJECT: REQUIREMENTS AND OPPORTUNITIES pptx
... x% of the offer acceptance rate, which is the equivalent of an average increase of revenues with more then y% annually The top management of a company appreciates that the CRM project application ... will allow the achievement of the fundamental objective that consists in the augmentation of the market share, by the means of the campaigns focalized on th...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: "Models for Sentence Compression: A Comparison across Domains, Training Requirements and Evaluation Measures" docx
... text and spontaneous speech as it has been scripted beforehand and is usually read off an autocue One stumbling block to performing a comparative study between written data and speech data is that ... president has left for three days of speeches and fundraising in Nevada, California and New Mexico g: The president left for three days of speeches and fundraising in Nevada, C...
Ngày tải lên: 31/03/2014, 01:20