... In Groundwater Of Bangladesh Field experience and available data shows that both soil and under groundwater of a vast area of Bangladesh has been threatened with arsenic contamination affecting ... Preliminary Results of Groundwater investigation in Arsenic affected areas in Bangladesh A Report Prepared by RGAG Japan RGAG(1999) Arsenic contamination of...
Ngày tải lên: 05/09/2013, 08:40
... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable – In grid networks (with high band...
Ngày tải lên: 15/01/2014, 15:59
Tài liệu Sounding the Event- Escapades in dialogue and matters of art, nature and time doc
... restless times from which comes background noise? Yes, how is such an image to greet the murmuring and the crackling and the tinkling and the crying and the sighing and rumbling and the roaring of ... birds and tree There was the agitation, the vacillation, the vibration There was, also, the movement of the time that made the time of day, the...
Ngày tải lên: 17/01/2014, 01:20
Tài liệu GENETICS IN PREVENTION AND TREATMENT OF CANCER ppt
Ngày tải lên: 15/02/2014, 04:20
Tài liệu Good practices in planning and management of integrated commercial poultry production in South Asia ppt
... Good practices in planning and management of integrated commercial poultry production in South Asia by R Prabakaran Professor of Poultry Science Tamil Nadu Veterinary and Animal Science ... researchers and those involved in development in general Good Practices in Poultry Production in South Asia Chapter Poultry Industry in South...
Ngày tải lên: 21/02/2014, 01:20
Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf
... should induce activation of all protein kinases shown to contribute to the neokyotorphin effect Both PKA and CaMK II are known to be activated by Ca2+ influx, in the case of CaMK II activation is ... established as neokyotorphin- effect mediators in L929 cells, are PKA, CaMK II and MAPK Discussion Fig Effect of lM neokyotorphin and 50 lM 8-Br-cAMP in L92...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
fraud and responsibilities of auditor in detecting and preventing of fraud
... about the responsibilities of both internal and external auditor in detecting and preventing fraud 2.3.1 Responsibilities of internal auditor Internal auditor plays an important role in fraud detection ... fraud and the responsibilities of auditor in detecting and preventing of fraud Fraud can be considered as most concerning problem of th...
Ngày tải lên: 13/03/2014, 14:20
FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION pptx
... Movements: Definitions, Data and Method 46 TURKEY, 1980-2000: FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION I Introduction Integration of the developing national ... extend of disassociation of the productive sphere of the domestic economy from its indigenous processes of accumulation and distribution As internationaliza...
Ngày tải lên: 15/03/2014, 19:20
comparing two documentaries one day in september and nanook of the north
... pieces are informing One day in September is more developed due to time it was produced The two show a big difference in the development of documentaries but I think Nanook was a very influential ... now and what he was like then In comparison One day in September is a better informing piece than Nanook because it uses more factors to keep the audience in...
Ngày tải lên: 21/03/2014, 21:59
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx
... of the diagnosis intervals and initiation of treatment intervals with respect to days One hundred and three patients (50.5%) had delays in diagnosis and 51 patients (25%) had delays in initiation ... Med, 1992; 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural...
Ngày tải lên: 22/03/2014, 18:20
Báo cáo " Distribution of Arsenic, Copper, Lead, Zinc elements in water and soils of sulfur deposits in the North West of Hanoi " pptx
Ngày tải lên: 28/03/2014, 15:20
báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx
... (IGF1R): Insulin-like Growth Factor- 1 receptor; (IGFBP-3): Insulin-like Growth Factor Binding Protein-3; (IGFBP-4): Insulin-like Growth Factor Binding; Protein-4; (MAPK): Mitogen-activated protein kinase; ... role of secreting IGFBPs in melanoma However, data not support the clinical utility of measuring levels of IGFBP-3 and -4 in sera of melan...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Overexpression of serine racemase in retina and overproduction of D-serine in eyes of streptozotocin-induced diabetic retinopathy" docx
... article as: Jiang et al.: Overexpression of serine racemase in retina and overproduction of D -serine in eyes of streptozotocin-induced diabetic retinopathy Journal of Neuroinflammation 2011 8:119 ... of excess retinal D -serine into the ocular humors Compared to those in adult retina, levels of D -serine were easily detected by reverse-phase HPLC in...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian cancer" pdf
... deletion or loss -of- function mutations in the survival of motor neuron (SMN) protein results in SMA [12] Gemin and Gemin are shared components of SMN and miRNAcontaining ribonucleoprotein particles ... overexpression of miR-375 resulted in suppressed glucose-stimulated insulin secretion and its inhibition resulted in enhanced insulin secretion Myotrophin, a protein that...
Ngày tải lên: 20/06/2014, 07:20