Give an account of a visit to a book exhibition

Báo cáo y học: "Effectiveness of strategies to encourage general practitioners to accept an offer of free access to online evidence-based information: a randomised controlled trial" docx

Báo cáo y học: "Effectiveness of strategies to encourage general practitioners to accept an offer of free access to online evidence-based information: a randomised controlled trial" docx

... study, funded by the Australian government, to examine the acceptance by Australian general practitioners (GPs) of an offer of free access to the online version of BMJ Clinical Evidence and its ... of different strategies designed to encourage GPs to accept an offer of free access to an online evidencebased resource and to participate in...

Ngày tải lên: 11/08/2014, 05:21

8 250 0
báo cáo khoa học: " Effectiveness of strategies to encourage general practitioners to accept an offer of free access to online evidence-based information: a randomised controlled trial" ppt

báo cáo khoa học: " Effectiveness of strategies to encourage general practitioners to accept an offer of free access to online evidence-based information: a randomised controlled trial" ppt

... the Australian government, to examine the acceptance by Australian general practitioners (GPs) of an offer of free access to the online version of BMJ Clinical Evidence and its subsequent use A ... Examine the effectiveness of different strategies designed to encourage GPs to accept an offer of free access to an online evidence-based r...

Ngày tải lên: 11/08/2014, 16:20

8 269 0
REGULATIONS AGAINST ABUSIVE PRICING  a COMPARISON OF EU, US AND  VIETNAMESE LAW AND AN APPLICATION OF ITS  RESULTS TO VIETNAM

REGULATIONS AGAINST ABUSIVE PRICING a COMPARISON OF EU, US AND VIETNAMESE LAW AND AN APPLICATION OF ITS RESULTS TO VIETNAM

... object of producing a thesis titled: Regulations against abusive pricing – A comparison of EU, US, and Vietnamese laws and an application of its results to Vietnam The results of my research ... REGULATIONS AGAINST ABUSIVE PRICING UNDER EU AND US LAW 2.1 Basic rules and concepts on abusive pricing in EU and US 2.1.1 Basic rule...

Ngày tải lên: 15/08/2014, 15:49

31 401 0
VCM 2012 12 Một phương pháp đánh giá về ảnh hưởng của bộ lọc đến  hình dạng tín hiệu điện tim  A method evaluates an effect of the filter to ECG signal

VCM 2012 12 Một phương pháp đánh giá về ảnh hưởng của bộ lọc đến hình dạng tín hiệu điện tim A method evaluates an effect of the filter to ECG signal

... Science and Engineering, 2011 [5] Wan-hua Lin, Mico Yee-Man Wong, Li-na Pu, Yuan-ting Zhang, “Comparison of Median Filter and Discrete Dyadic Wavelet Transform for Noise Cancellation in Electrocardiogram”, ... Discrete Wavelet Transform for Quality Diagnosis of Biomedical ECG Signal, International Journal of Computer Applications, 2011 [7] Mikhled Alfaouri and Khaled Daqrouq, ECG...

Ngày tải lên: 25/07/2015, 07:27

8 465 1
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... with severe trauma: an audit of a Norwegian helicopter emergency medical service Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010 18:3...

Ngày tải lên: 25/10/2012, 09:56

6 612 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

... Can, Le Thanh Duong and Ryuichi Yamada, 2002 A < /b> Participatory < /b> Research < /b> Approach < /b> Supporting Small-Scale Household Farming Development in < /b> Rainfed < /b> Lowland < /b> in < /b> Bac Lieu In:< /b> Proceedings of < /b> the 2002 annual ... participatory < /b> research < /b> approaches to support the small-scale household farming in < /b> utilizing and managin...

Ngày tải lên: 16/01/2014, 21:20

8 493 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
An autobiography of a story book pptx

An autobiography of a story book pptx

... would then be able to lead a more comfortable life Perhaps I can invent cars that are operated by robots or a computer that thinks like a human My parents think highly of my ambition and are very ... understand the answer In class, I always make sure that I perform each science experiment properly When in doubt, I consult my teachers As a scientist, I would be able to invent new thi...

Ngày tải lên: 22/07/2014, 03:21

6 385 0
An autobiography of a pen doc

An autobiography of a pen doc

... skins and then crawled out of the old ones We then turned into large grey, yellow and orange striped caterpillars My next stage was the pupa stage I crawled under a leaf of the plant and spun a pod ... leaf of a milkweed plant After several days we hatched into tiny black and white larvae At this stage we were called tiny caterpillars We moved about the plant and fed on its fleshy...

Ngày tải lên: 22/07/2014, 03:21

6 502 0
An autobiography of a dancing doll ppsx

An autobiography of a dancing doll ppsx

... lady came to the store She looked around the place and her eyes felon me She looked at me in admiration She at once bought me I was given as a birthday present to her only daughter Pam I was ... let her friends handle me When Pam was not attending to me, one of her friends picked me up Pam was furious and tried to pull me away form her friend In the tussle they accidentally ripped my pre...

Ngày tải lên: 22/07/2014, 03:21

4 233 0
Báo cáo toán học: "An extension of a criterion for unimodality" pps

Báo cáo toán học: "An extension of a criterion for unimodality" pps

... if a j sequence is log concave then it is unimodal [5] A sufficient condition for log concavity of a polynomial is given by the location of its zeros: if all the zeros of a polynomial are real and ... Log-concave and unimodal sequences in Algebra, Combinatorics and Geometry: an update Contemporary Mathematics, 178, 71-84, 1994 [4] Stanley, R.: Log-concave and unimodal sequences...

Ngày tải lên: 07/08/2014, 06:22

7 331 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa

An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa

... students at Thanh Hoa Vocational School of Commerce- Tourism after applying a discourse-based approach in teaching English reading skill - To investigate what extent the application of a discourse-based ... context of teaching and learning reading comprehension at Thanh Hoa Vocational School of Commerce- Tourism Thanh Hoa Vocational...

Ngày tải lên: 28/03/2015, 09:26

66 706 0
w