「めく」 to indicate an atmosphere of a state

... brand awareness: • Involve a slogan or jingle: a slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are powerful and can be a ... or a trademark Prasad and Dev (2000) also states that a brand can be seen to include all tangible and intangible attributes that a business stands for Despite the fact that lots of global and ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its...

Ngày tải lên: 24/09/2012, 17:19

... interact with membrane via the formation of an oblique-orientated a- helix [26], a class of a- helices [29– 35] that penetrate membranes at a shallow angle because of a hydrophobicity gradient along ... Gaussian and Lorentzian bandshapes Best fits were obtained by assuming a Gauss fraction of 0.55–0.6 The CURFIT procedure measures the peak areas of single band components and, after statistical evaluation, ... The software was also used to represent both this sequence and that of HA2 as two-dimensional axial projections assuming an angular periodicity of 100 ° (Fig 3) Haemolytic assay of VP1 Haemolytic...

Ngày tải lên: 17/03/2014, 10:20

... contributed to data analysis, and interpretation RSF was responsible for design of study, and contributed to data analysis, interpretation, and writing of paper All authors acknowledge that they have approved ... usage appears to have been a significant disincentive to acceptance of the resource Ethical approval Ethics approval was given by the Royal Australian Collage of General Practitioner's National ... the Australian government, to examine the acceptance by Australian general practitioners (GPs) of an offer of free access to the online version of BMJ Clinical Evidence and its subsequent use A...

Ngày tải lên: 11/08/2014, 05:21

... contributed to data analysis, and interpretation RSF was responsible for design of study, and contributed to data analysis, interpretation, and writing of paper All authors acknowledge that they have approved ... usage appears to have been a significant disincentive to acceptance of the resource Ethical approval Ethics approval was given by the Royal Australian Collage of General Practitioner's National ... the Australian government, to examine the acceptance by Australian general practitioners (GPs) of an offer of free access to the online version of BMJ Clinical Evidence and its subsequent use A...

Ngày tải lên: 11/08/2014, 16:20

... as Hispanic, and categorising all non-Hispanics according to race group (black, Asian, American Indian/Alaska Native, white) Age categories employed in standardisation and calculation of age-specific ... a paucity of data on sepsis-associated mortality rates in Hispanics, American Indians/ Alaska Natives and Asians Earlier studies found that, relative to whites, blacks and other non-whites have ... curves of blacks and American Indians/Alaska Natives indicate a similar early onset of vulnerability for sepsis-related death The occurrence of parallel patterns of vulnerability in two racially-disparate...

Ngày tải lên: 13/08/2014, 15:22

... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...

Ngày tải lên: 25/10/2012, 09:56

... non-financial performance measures such as customer and employee satisfaction, customer and employee retention and quality measures and financial indicators such as profitability (Banker and Mashruwala, ... Research, 10, 205-38 Ittner, C.D and D.F Larcker (1998b), ``Are non-financial measures leading indicators of financial performance? An analysis of customer satisfaction’’, Journal of Management Accounting ... Customer Satisfaction, and Financial Performance, University of Texas, Dallas working paper Banker, R D., Potter, G and D Srinivasan (2001), An Empirical Investigation of an Incentive Plan that...

Ngày tải lên: 20/12/2013, 17:15

... of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources to ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...

Ngày tải lên: 16/01/2014, 21:20

... population has a distribution of ages, and expectation of remaining life is age-dependent Therefore, in quantification, it is an advantage to arrange the calculations in a two-dimensional array ... COMMITTEE OF THE ENVIRONMENTAL AND OCCUPATIONAL HEALTH ASSEMBLY OF THE AMERICAN THORATIC SOCIETY (ATS) Health effects of outdoor air pollution, Part American journal of respiratory and critical care ... COMMITTEE OF THE ENVIRONMENTAL AND OCCUPATIONAL HEALTH ASSEMBLY OF THE AMERICAN THORATIC SOCIETY (ATS) Health effects of outdoor air pollution, Part American journal of respiratory and critical care...

Ngày tải lên: 17/02/2014, 11:20

... Tagging and Processing Large Textual Corpora Presented at the 28th annual meeting of the ACL, June 1990 [Salton, 1989] J Salton Automatic Text Processing, The Transformation, Analysis, and Retrieval ... Orsay, France, 1982 Th~se de Doctorat D'~tat [Hindle and Rooth, 1990] D Hindle and M Rooth Structural Ambiguity and Lexieal Relations In DARPA Speech and Natural Language Workshop, Hidden Valley, ... words For example, takeover and thwart with a distance of Output/Goah Either a syntactic label for the bigram or a rejection In the case of takeover and thwart the collocation is accepted and its...

Ngày tải lên: 08/03/2014, 07:20

... Software Installing an antivirus and antispyware software program and keeping it up to date is a critical step in protecting your computer Many types of antivirus and antispyware software can detect ... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic ... and install all available updates Enable automatic updates if your vendors offer it; that will ensure your software is always updated, and you won’t have to remember to it yourself Many operating...

Ngày tải lên: 14/03/2014, 22:20

... FABRY, California State University, San Marcos GRETCHEN E HOFMANN, University of California, Santa Barbara DANIEL S HOLLAND, Gulf of Maine Research Institute, Portland JOAN A KLEYPAS, National ... management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that would go ... of the FOARAM Act are to: • • • • develop and coordinate an interagency plan for monitoring and research, establish an ocean acidification program within NOAA, assess and consider ecosystem and...

Ngày tải lên: 15/03/2014, 15:20

... example, it is known that high aeration and logarithmic growth of the bacteria leads to a predominance of Q-8, whereas under anaerobic conditions and in stationary phase MK-8 is the predominant ... Bordetella pertussis BvgAS signal transduction cascade Proc Natl Acad Sci USA 91, 1163–1167 Utsumi, R., Katayama, S., Taniguchi, M., Horie, T., Ikeda, M., Igaki, S., Nakagawa, H., Miwa, A & Noda, M ... of the transmitter domain of the BvgS protein [13] Similarly, the EvgS protein contains a sequence with characteristics of a PAS domain between its transmembrane and transmitter domains (data...

Ngày tải lên: 17/03/2014, 23:20

... 2006 J Am Chem Soc 128 5468 923 Kotsikau D, Ivanovskaya M, Orlik D and Falasconi M 2004 Sensor Actuat B101 199 Rumyantseva M et al 2006 Sensor Actuat B118 208 Sorescu M, Diamandescu L, Tarabasanu-Mihaila ... HRTEM image and the SAED pattern may also be indexed to hexagonal phase of α-Fe2O3 The observed lattice spacings of 0⋅370 and 0⋅269 nm correspond to the (012) and (104) planes of hexagonal α-Fe2O3, ... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 180°C for...

Ngày tải lên: 19/03/2014, 16:48

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... between Marx and Soviet authoritarianism is a complex historical and theoretical problem, unsatisfactorily explained with recourse to formulae about Marx's 'utopianism' In an area as contentious as ... the actual links between Marx and Lenin there lies a 'weak link', or an 'original sin', which makes the transition from Marx to Lenin, and thence to an authoritarian state a necessary, inevitable, ... economic tasks of the transition: the centralization of the means of production and credit in the hands of the state; abolition of the right of inheritance, and of property in land; a heavy, progressive...

Ngày tải lên: 31/05/2014, 00:40

... objective of this paper is to show another generalization of Mann and Halpern iterative algorithm to a setting of a finite family of nonexpansive mappings We deal with the iterative scheme x0 ∈ C and ... Analysis and Applications, vol 211, no 1, pp 71–83, 1997 [5] W Takahashi, T Tamura, and M Toyoda, “Approximation of common fixed points of a family of finite nonexpansive mappings in Banach spaces,” ... nonexpanding maps,” Bulletin of the American Mathematical Society, vol 73, pp 957–961, 1967 [9] Y Kimura, W Takahashi, and M Toyoda, “Convergence to common fixed points of a finite family of nonexpansive...

Ngày tải lên: 22/06/2014, 18:20

... would then be able to lead a more comfortable life Perhaps I can invent cars that are operated by robots or a computer that thinks like a human My parents think highly of my ambition and are very ... understand the answer In class, I always make sure that I perform each science experiment properly When in doubt, I consult my teachers As a scientist, I would be able to invent new things for mankind ... pages and soon I was as good as new Till today I am with her giving her delight through my stories I love her very much My ambition My ambition is to become a successful scientist I have always...

Ngày tải lên: 22/07/2014, 03:21

... skins and then crawled out of the old ones We then turned into large grey, yellow and orange striped caterpillars My next stage was the pupa stage I crawled under a leaf of the plant and spun a pod ... leaf of a milkweed plant After several days we hatched into tiny black and white larvae At this stage we were called tiny caterpillars We moved about the plant and fed on its fleshy green leaves ... I was on display for only a short period A grand old lady came to the store one day She was looking for a gift She bought me and presented me to a girl named Mary Mary is a student and used...

Ngày tải lên: 22/07/2014, 03:21