... included an attack on illiteracy as one of their goals, with the former Soviet Union, China, and Cuba being among the most successful in the 20th century According to the passage, the anti-illiteracy ... until the end of the 14th century Illiteracy was not seen as a problem until the end after the invention of printing in the 15th century The first significan...
Ngày tải lên: 23/11/2013, 10:11
End of the Tether
... with the tiny competition of their beats He rose at five every day The officer of the morning watch, drinking his early cup of coffee aft by the wheel, would hear through the wide orifice of the ... to the very end of the piece In fine weather, in the second dog-watch, the two men could hear her trills and roulades going on to the accompaniment of the pia...
Ngày tải lên: 06/11/2012, 17:32
... that the thesis entitled ORGANIZING PAIRWORK AND GROUPWORK IN THE CONTEXT OF HIGH SCHOOL CLASSROOMS AT PHAM VAN NGHI UPPER SECONDARY SCHOOL, NAM DINH PROVINCE: A CASE STUDY Is the result of my own ... related to the study : Communicative approach to language teaching, and pairwork and groupwork in language teaching and lear...
Ngày tải lên: 07/11/2012, 14:54
DESIGNING AN END OF YEAR ENGLISH OBJECTIVE TEST FOR 1ST YEAR NON MAJOR ENGLISH STUDENTS OF THE ACADEMY OF FINANCE
... different kind of test for the non- major English students Therefore, in my research, designing an end- of- year English objective test for 1st year non- major English students of the Academy of Finance really ... an end- of- year English objective test for 1st year non- major English students of the Academy o...
Ngày tải lên: 07/09/2013, 13:19
The end of Angevin Brittany, 1186-1203
... discussion of the institution in the period after 1186 in the context of the role of the Angevin kings, rather than of the dukes' internal government Roger of Howden's account of the rebellion of Guihomar ... the family of the earls of Richmond/dukes of Brittany, which enhanced relations between the Bretons and their neighbours The chronology of...
Ngày tải lên: 01/11/2013, 07:20
Sincerity and the end of theodicy - three remarks on Levinas and Kant
... itself endlessly Levinas s response to this return of the refuted is twofold On the one hand, it attests to the saying of the said, to the fact that the self-contradictory nature of the thesis (the ... constitute an exposition of a subject called to critique Think of that exposition as the description of suffering and that critique as the critique of the...
Ngày tải lên: 01/11/2013, 10:20
The final Test of the 1st term grade 1
... reach the bookshelf 5-What color are they? They’re II- Write the sentences or give the answers: 1- Who is she ? She 2- I can _ 3- Are they toes ? No, they aren’t They’re ... B- WRITING: (10 pts) I- Complete and match up:(5 pts) 1- I can’t _ grandfather 2- Who is he? thin He’s my _ 3- Is she fat? giraffe No
Ngày tải lên: 09/11/2013, 01:11
An investigation into the participation of high school students in speaking lessons = khảo sát về sự tham gia của học sinh trong giờ học nói tiếng anh tại trường THPT
... School Students in Speaking Lessons PART III: CONCLUSION This study is about the investigation into the participation of high school students in speaking lessons with the main aims at finding out the ... Languages Department - Vinh University 29 An Investigation into the Participation of High School Students in Speaking Lessons R...
Ngày tải lên: 18/12/2013, 10:08
Tài liệu The life is at the end of the road doc
... The life is at the end of the road 2010 so sánh số với nước láng giềng Campuchia có 6%, Lào có 13% Thái Lan 9% Theo GS TS Lê Đình Quang, viện nghên cứu ... gió rôto [m2] ρV3 [W/m2] Công suất trục rôto tính theo công thức: P = Think green and action green Page 2 The life is at the end of the road 2010 Một số lưu ý lắp đặt tua bin gió Nói chung, ... thiết kế cho nhà rẻ b ó máy phá...
Ngày tải lên: 25/01/2014, 09:20
Tài liệu The long-term reproductive health consequences of female genital cutting in rural Gambia: a community-based survey doc
... several large ethnic groups in The Gambia (Singhateh 1985) A national campaign to eliminate FGC in The Gambia was launched in 1997 In the same year, the government banned national radio and television ... partial or total removal of the clitoris together with partial or total excision of the labia minora Type III is partial or total removal of the external genita...
Ngày tải lên: 13/02/2014, 16:20
Tài liệu The cycle of preference: Long-term dynamics of aesthetic appreciation docx
... changed the instruction for the participants in Study by providing them with information on the production time of the respective car models and asking them to evaluate them on the basis of the historic ... influencing the aesthetic judgment of already known designs, we should register the changes for key design variables such as the innovativeness or the quality o...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: "Is the End of Supervised Parsing in Sight?" pdf
... derivations, the probability of a tree is the sum of the probabilities of the derivations producing that tree The probability of a derivation is the product of the subtree probabilities The original ... sentences, resulting in a total training set of 4,040k sentences We believe that our result is quite promising for the future of unsupervised parsing In p...
Ngày tải lên: 20/02/2014, 12:20