MicrowaveAssisted Fluorous Synthesis of a 1,4Benzodiazepine2,5dione Library
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... appeared By comparison with the spectrum of N1-liganded GABARAP (A) , these resonance signals can be attributed to N1-liganded GABARAP By binding to GABARAP, N1 peptide displaces CRT from GABARAP A few ... A dissociation constant of 64 nm for the GABARAP CRT interaction was Calreticulin is a high affinity ligand for GABARAP Fig Homology model of CRT(1–332) with...
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase ... The DNA fragment coding the scFvLH (10 pg) was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LAT...
facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures
... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 18 0°C ... water and absolute ethanol respectively, and finally dried in air at 60°C The XRD pattern of prepared powder sample was collected using a Rigaku D/ Max-2200PC X-ray diffractom...
simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions
... Srivastava, A K; Nandedkar, R V Growth and characterization of alpha-Fe2O3 nanowires J Appl Phys 2007, 102, 054303 [14] Dong, W T.; Zhu, C S Use of ethylene oxide in the sol gel synthesis of alpha-Fe2O3 ... Material (ESM) In spite of intensive research into one-dimensional structures of metal oxides in particular and NWs in general, our understanding of the mechanisms of...
Báo cáo hóa học: " A truly green synthesis of a-aminonitriles via Strecker reaction" pdf
... enantioselective Strecker reactions and analogous syntheses Chem Rev 103:2795–2827 doi:10.1021/cr020038p Arasappan A, Venkatraman S, Padilla AI, Wu W, Meng T, Jin Y, Wong J, Prongay A, Girijavallabhan V, ... GKS, Mathew T, Panja C, Alconcel S, Vaghoo H, Do C, Olah GA (2007) Gallium (III) triflate catalyzed efficient Strecker reaction of ketones and their fluorinated analogs Proc Nat A...
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc
... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a C...
Báo cáo sinh học: "Construction and characterization of a BAC library from a gynogenetic channel catfish Ictalurus punctatus" pps
... culture was aliquoted and stored at −80 ◦ C for subsequent screening by hybridization 2.2 Characterization of the BAC library BAC DNA was isolated from 100 colonies randomly chosen from each fraction ... and µL was used to inoculate a new overnight culture This was repeated on day 2, 3, 4, and until 100 generations had passed BAC DNA from each clone was prepared as a...
Toward synthesis of a macrocyclic hybrid aromatic pentamer
... TOWARD SYNTHESIS OF A MACROCYCLIC HYBRID AROMATIC PENTAMER SUN XIAONAN (M.Sc.) PKU A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF CHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE ... synthetic facility, high structural diversity and adaptability In this regard, the aim of this study was to design and synthesize a new class of cyclic pentamer w...
SolidPhase Synthesis of Tetrahydro1,4 benzodiazepine2one Derivatives as a βTurn Peptidomimetic Library
... to build a useful peptidomimetic library Benzodiazepine classes have been an important class of compounds that have displayed selective activities against a diverse array of biological targets,10,11 ... Solid-Phase Synthesis of Tetrahydro-1,4-benzodiazepine-2-one Derivatives as a β-Turn Peptidomimetic Library Isak Im,† Thomas R Webb,‡ Young-Dae Gong,§ Jae-Il Kim,† an...
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...
Tài liệu Management Information Systems A Synthesis of Transit Practice ppt
... Authority Atlanta, Georgia Metro-Dade Transit Agency Miami, Florida San Francisco Bay Area Rapid Transit District Oakland, California Metra (Metropolitan Rail) Chicago, Illinois MTA New York City Transit ... sophisticated applications in at least one of the four management and operational areas under consideration (i.e., administration, planning and operations, materials management...
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx
... characterization of native a-conotoxins Analysis of neuronally active a-conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard procedures ... 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271) 2299 Fig LC/MS analysis of crude venom from C geographus Example of experime...
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/medium_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its tar...
Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt
... confirming the adenylylation of these compounds and the absence of synthesis of poly(A) by the E coli poly(A) polymerase, we did not observed adenylylation of guanosine, GDP or Gp4G by the yeast enzyme ... independent synthesis of poly(A) In order to understand why dinucleoside polyphosphates activated the primer independent synthesis of poly...