7515 who is who in the class
7515 who is who in the class
...
- 2
- 174
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
... 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI ... 93 3A 94 4A Satomura T, Kawakami R, Sakuraba H & Ohshima T (2002) Dye-linked d-proline dehydrogenase from hyperthermophilic archaeon Pyrobaculum islandicum is a novel FAD-dependent amino acid dehydrogenase ... kDa), catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa) and ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences The...
- 11
- 549
- 0
Tài liệu Báo cáo khoa học: "THERE STILL IS GOLD IN THE DATABASE MINE" potx
... of the current interest in database interfaces and in which considerable research is needed Large, shiny nuggets of theory are waiting to be discovered by enterprising computational linguists! ... database query, but this need not be the case The point of the spectrum is that there is a continuum from "database" to "knowledge base", and that the supposed limitations of one arise from the ... generalize to the other The fault lies in the inadequate theories, not in the problem environment, and radically changing the problem environment will not guarantee the development of better theories...
- 2
- 432
- 0
Processing Fluency and Aesthetic Pleasure: Is Beauty in the Perceiver''''s Processing Experience? pptx
... exaggerated forms, and why artists and scientists have often considered truth and beauty as two sides of the same coin Processing Fluency The Concept of Processing Fluency The processing of any stimulus ... instead from the processing experiences of the perceiver Is beauty therefore in the eye of the beholder? In a sense it is, if folk wisdom thinks of the eye as the perceptual processes of the beholder ... However, beauty "in the eye of the beholder" has often been contrasted to "objective beauty. " The fluency hypothesis resolves this apparent contradiction: Beauty is in the processing experiences of the...
- 20
- 514
- 0
Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc
... that mitochondria contribute to the induction of oxidative stress during ischemia ⁄ reperfusion in brain There is a growing body of information concerning the mechanism of ROS generation by the ... ADP inhibits opening of the mPTP by occupying binding sites located in the inner and outer mitochondrial membrane [39,40] The binding of ADP stabilizes the matrix conformation of the adenine ... brain mitochondria in the presence of these electron donors This is of relevance in brain, because in this tissue glucose is metabolized providing the NADH-yielding substrate pyruvate Under these...
- 9
- 433
- 0
Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc
... polyglutamine-expanded huntingtin [18], the tumor suppressor Synoviolin is involved in the degradation of nicastrin gene p53 [19] and Parkin-associated endothelin receptor-like receptor [20] In this ... whether Synoviolin is involved in the degradation of PS cofactors using synoviolin-null cells, as PS cofactors undergo the ubiquitin ⁄ proteasome pathway We report that Synoviolin is involved in ... in the degradation of immature NCT and regulates Ab generation Results Accumulation of immature NCT in synoviolin-null cells To investigate whether Synoviolin is involved in the degradation of...
- 9
- 561
- 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... explained by the single AhR pathway The molecular mechanism involved in the AhR-independent pathway( s) leading to TCDDinduced immunotoxicity is not clearly understood, and indeed the lack of a ... PKCh and specifically sup906 press its kinase activity To confirm that PKCh kinase activity really does participate in the signal transduction mechanism involved in TCDD-induced L-MAT cell apoptosis, ... dependent on an AhR gene locus [9,10], and we have already confirmed, by using the human lymphoblastic T-cell line, L-MAT, as the model, that the AhR-mediated pathway is in no way involved in TCDD-induced...
- 13
- 426
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC ... CARP is a substrate of calpain Considering the sarcomeric localization of both CARP and calpain and the fact that calpain cleaves another member of the MARPs family, the possibility that CARP could...
- 16
- 462
- 0
Hướng dẫn khắc phục lỗi “username is not in the sudoers file...” trong Ubuntu doc
... sudo nano /etc /sudoers - Và nhập đoạn mã vào file hiển thị: # # This file MUST be edited with the 'visudo' command as root # # Please consider adding local content in /etc /sudoers. d/ instead of # ... ALL # Members of the admin group may gain root privileges %admin ALL=(ALL) ALL # Allow members of group sudo to execute any command %sudo ALL=(ALL:ALL) ALL #includedir /etc /sudoers. d - Nhấn Ctrl ... Còn file /etc /sudoers hệ thống không lúc đầu, bạn thực thao tác giống bước – nhấn Enter hiển thị thông báo Finished Sau đó: - Tại giao diện dòng lệnh, gõ: sudo cp /etc /sudoers /etc /sudoers. backup...
- 4
- 860
- 1
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
... Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C (2005) Transactivation of the EGF receptor and a PI3 kinase-ATF-1 pathway is involved in the upregulation of NOX1, a catalytic subunit of NADPH ... Suzuki E, Nishimatsu H, Satonaka H, Walsh K, Goto A, Omata M, Fujita T, Nagai R & Hirata Y (2002) Angiotensin II induces myocyte enhancer factor 2- and calcineurin ⁄ nuclear factor of activated T ... N, Nishinaka T, Miyagishi M, Taira K & Yabe-Nishimura C (2005) Essential role of ATF-1 in induction of NOX1, a catalytic subunit of NADPH oxidase: involvement of mitochondrial respiratory chain...
- 9
- 452
- 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc
... cysteine residue (Cys28) at the frontier between the membrane and the intermembrane space The predicted membrane- spanning segment of subunit e displays the dimerization motif GxxxG of glycophorin ... to identify the interaction domains between subunit g and subunits e and The oligomeric forms of the yeast ATP synthase in the inner mitochondrial membrane The unique cysteine residue of the wild-type ... allowing the dimerization/oligomerization of the yeast ATP synthases This role and these interfaces will be more precisely studied by site-directed mutagenesis of the ATP2 0 gene encoding subunit...
- 10
- 550
- 0
báo cáo hóa học:" Sperm protein 17 is expressed in the sperm fibrous sheath" ppt
... designates Sp17 as a novel FS protein and shows the continuous presence of this protein throughout the sperm tail from ejaculated spermatozoa to the sperm- ZP binding phase These data contribute to the ... understanding of Sp17's biological role and its possible clinical implications Abbreviations AKAPs: kinase anchoring proteins; PKA: protein kinase A; Sp17: sperm protein 17; ZP: zona pellucida Competing ... L: A re-evaluation of sperm protein 17 (Sp17) indicates a regulatory role in an A-kinase anchoring protein complex, rather than a unique role in sperm- zona pellucida binding Reproduction 2002,...
- 5
- 435
- 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf
... across the BBB to the sites of axonal injury in the brain [33,37] Both in vitro and in vivo findings suggest that hypoxia/ischemia-induced infiltration of monocytes and macrophages contributes to the ... of inflammatory cytokines and chemokines during hypoxia; whereas NFκB is mainly involved in transcriptional regulation of these genes during the phase of reoxygenation [8,40] The temporal interplay ... MCP-5 gene and the observation that the expression of MCP-5 correlated with the levels of HIF-1α suggest that HIF-1α is involved in transcriptional regulation of MCP-5 expression in mouse astrocytes...
- 15
- 541
- 0
Từ khóa: husband who is asleep in the next roomwho s who in the world of auditswho s who in the industrywho s who in the dental teamwhat is this that it is a an to talk about things in the classroomwho s who in the art of doingpairs one describes a thing in the class room and the other guesses what it iswho s who in the real estate business and how do they get therewho s who in the telecommunications worldwho s who in the international standards worldwho s who in the internet standards worldwork and play a in the class mai is a student at quang trung school she is in grade 7 she goes to school six days a week from monday to saturdayusername is not in the sudoers fileteaching culture in the classroomteaching methods in the classroomchuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ