7515 who is who in the class
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
... 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI ... 93 3A 94 4A Satomura T, Kawakami R, Sakuraba H & Ohshima T (2002) Dye-linked d-proline dehydrogenase from hyperthermophilic archaeon Pyrobaculum islandicum is a novel FAD...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: "THERE STILL IS GOLD IN THE DATABASE MINE" potx
... of the current interest in database interfaces and in which considerable research is needed Large, shiny nuggets of theory are waiting to be discovered by enterprising computational linguists! ... database query, but this need not be the case The point of the spectrum is that there is a continuum from "database" to "knowledge base", and that the supposed limitations of...
Ngày tải lên: 21/02/2014, 20:20
Processing Fluency and Aesthetic Pleasure: Is Beauty in the Perceiver''''s Processing Experience? pptx
... exaggerated forms, and why artists and scientists have often considered truth and beauty as two sides of the same coin Processing Fluency The Concept of Processing Fluency The processing of any stimulus ... instead from the processing experiences of the perceiver Is beauty therefore in the eye of the beholder? In a sense it is, if folk wisdom thinks...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc
... that mitochondria contribute to the induction of oxidative stress during ischemia ⁄ reperfusion in brain There is a growing body of information concerning the mechanism of ROS generation by the ... ADP inhibits opening of the mPTP by occupying binding sites located in the inner and outer mitochondrial membrane [39,40] The binding of ADP stabilizes...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc
... polyglutamine-expanded huntingtin [18], the tumor suppressor Synoviolin is involved in the degradation of nicastrin gene p53 [19] and Parkin-associated endothelin receptor-like receptor [20] In this ... whether Synoviolin is involved in the degradation of PS cofactors using synoviolin-null cells, as PS cofactors undergo the ubiquitin ⁄ proteasome pathway We r...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... explained by the single AhR pathway The molecular mechanism involved in the AhR-independent pathway( s) leading to TCDDinduced immunotoxicity is not clearly understood, and indeed the lack of a ... PKCh and specifically sup906 press its kinase activity To confirm that PKCh kinase activity really does participate in the signal transduction mechanism invo...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTA...
Ngày tải lên: 29/03/2014, 21:20
Hướng dẫn khắc phục lỗi “username is not in the sudoers file...” trong Ubuntu doc
... sudo nano /etc /sudoers - Và nhập đoạn mã vào file hiển thị: # # This file MUST be edited with the 'visudo' command as root # # Please consider adding local content in /etc /sudoers. d/ instead of # ... ALL # Members of the admin group may gain root privileges %admin ALL=(ALL) ALL # Allow members of group sudo to execute any command %sudo ALL=(ALL:ALL) ALL #includedir /etc /sudoers. d...
Ngày tải lên: 30/03/2014, 00:20
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
... Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C (2005) Transactivation of the EGF receptor and a PI3 kinase-ATF-1 pathway is involved in the upregulation of NOX1, a catalytic subunit of NADPH ... Suzuki E, Nishimatsu H, Satonaka H, Walsh K, Goto A, Omata M, Fujita T, Nagai R & Hirata Y (2002) Angiotensin II induces myocyte enhancer factor 2- and calcineurin ⁄ n...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc
... cysteine residue (Cys28) at the frontier between the membrane and the intermembrane space The predicted membrane- spanning segment of subunit e displays the dimerization motif GxxxG of glycophorin ... to identify the interaction domains between subunit g and subunits e and The oligomeric forms of the yeast ATP synthase in the inner mitochondrial...
Ngày tải lên: 31/03/2014, 01:20
báo cáo hóa học:" Sperm protein 17 is expressed in the sperm fibrous sheath" ppt
... designates Sp17 as a novel FS protein and shows the continuous presence of this protein throughout the sperm tail from ejaculated spermatozoa to the sperm- ZP binding phase These data contribute to the ... understanding of Sp17's biological role and its possible clinical implications Abbreviations AKAPs: kinase anchoring proteins; PKA: protein kinase A; Sp17: sperm protein...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf
... across the BBB to the sites of axonal injury in the brain [33,37] Both in vitro and in vivo findings suggest that hypoxia/ischemia-induced infiltration of monocytes and macrophages contributes to the ... of inflammatory cytokines and chemokines during hypoxia; whereas NFκB is mainly involved in transcriptional regulation of these genes during the phase o...
Ngày tải lên: 19/06/2014, 22:20