Sample role plays from ESL role plays
Sample role plays from ESL role plays
... guests try to get their money back Preparation - Copy / cut role play cards before class Prepare one role play card per hotel owner and one role play card per pair of guests Divide students into groups ... family’s restaurant, but when you graduated from culinary school it closed because of this restaurant You got a job here so you could destroy the restaurant from the inside It’s almost closed, but ... hotel guests’ card Explain any unfamiliar vocabulary from the cards, i.e., refund, horrible, etc Give students time to think of arguments for their role Tell students they must find a way to resolve...
- 9
- 154
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis demonstrated that a substantial amount ... transgalactooligosaccharides listed in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, ...
- 9
- 669
- 0
Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot
... 5¢-GATTCTTAGCAGGTTCATCGCCATCT-3¢ 5¢-TGCACACACTTGGACAGAACAC-3¢ 5¢-GCGAAAACCTAGCTTGGGGAAG-3¢ 5¢-TATATAACGTGAAATGGACGC-3¢ 5¢-GAAGCTCTTCAGGAGGCACTTCCT-3¢ 5¢-CAATGGTGGGTACGCAGAGAGGAT-3¢ 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ ... three important phytopathogenic fungi: R solani, Rhizopus nigricans and Phytophthora parasitica var nicotianae The antifungal activity towards R solani was prominent (Fig 4A) , with antifungal action ... NtKTI1 may function as an antifungal protein to several phytopathogens during the plant defense response Materials and methods Plant materials and treatments Tobacco plants (Nicotiana tabacum L...
- 13
- 501
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... have used this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, ... of the a1 b1 or a2 b2 contact greatly suppresses the autoxidation rate, particularly of the b chains [8] In the autoxidation reaction of HbO2, as well as MbO2, pH can affect the rate in many different ... At the a1 b1 and a2 b2 interfaces, on the other hand, negligible changes are found insofar as the crystal structure was examined Consequently, these are called simply the packing contacts, and their...
- 10
- 648
- 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
... et al MT1-MMP and furin can interact with GRASP55 Overexpression of GRASP55 has been found to increase the amount of complex containing MT1MMP and furin, and the expression of a catalytically inactive ... with a full-length furin cDNA, were permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane compartment containing GRASP55 and furin Scale ... general mechanism for furin- mediated activation of transmembrane substrates The activation of ADAM17 by furin [68] and our observation of an interaction between GRASP55 and the ICD of ADAM17...
- 18
- 603
- 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
... derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA ... Transit peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75, and mToc75 with the ... Transit peptide of Toc75 A J Baldwin and K Inoue A B C Fig Effects of replacements of the most C-terminal tri-glycine segment within the polyglycine stretch of the Toc75 transit peptide with repeats...
- 9
- 496
- 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx
... identical to that of ePAD or AAH53724 (an egg and embryo abundant peptidylarginine deiminase) Mouse cortical granules contain PAD To ascertain if mouse cortical granules contain PAD, antibodies made ... a classical marker for mouse oocyte cortical granules [23] This lead to the conclusion that calreticulin is localized in a population of granules that is distinct from classical cortical granules ... double labeled with ABL2 and LCA All anti-PAD V labeling is shown in green, except in A where it is red DNA stain in A is green ABL2 labeling is green and LCA labeling is red in all figures (A) Cytospin...
- 22
- 519
- 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot
... single cysteine mutations, and demonstrated that this helix plays a prominent role in the coupling process in ABCB1 [25–28] A number of mutations in TM6 caused alterations in drug- stimulated ATP ... Catalytic intermediate CM BM FM Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP ... drug- binding site(s) and TM12 In fact, mutations in TM12 were demonstrated to affect transport or ATPase activity [32,33], in particular, the stimulation of ATP hydrolysis by vinblastine and nicardipine...
- 12
- 380
- 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... 5579 fad49 plays a crucial role in adipogenesis T Hishida et al Fig Characterization of the PX domain of FAD49 (A) Phosphoinositide binding specificity of the PX domain of FAD49 Bacterially expressed ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using...
- 13
- 385
- 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx
... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-3¢ for Akr1b8; ... primers were as follows: 5¢-CCCCTTACAGCTCTG CTTCATT-3¢ and 5¢-TCAAGAATGGATACACATAAA CACAAGGA-3¢ for Cyp2c29; 5¢-CCAGCTCTGCTTCAT TCCTCTCT-3¢ and 5¢-CGCAGGAATGGATAAACATA AGCA-3¢ for Cyp2c38; 5¢-ACTTCTCTGTGGCAAGCCC...
- 9
- 280
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... carried out in duplicate isolated and incubated in the same way as the experiments with MonoMac cells (Fig 3) In addition to TNF -a, the in ammatory cytokine IL-6 was also measured to check that ... LPCAT may alter the cell membrane lipid environment so as to favor the assembly of a signaling complex which can then activate the cellular response [15] To elucidate the role of LPCAT in the ... signaling pathways in monocytes In addition, LPCAT was found to be crucial for IL-6 production in a similar manner, indicating that it may generally in uence monocyte in ammatory cytokine responses to...
- 7
- 322
- 0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt
... was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was determined by impedance ... than aspirin in inhibiting the effect of ADP on platelets in blood and (2) NSC23766 inhibits a- granule secretion and platelet aggregation stimulated by ADP independent of platelet prostaglandin-endoperoxide ... inhibits platelet aggregation upon stimulation of blood and PRP by TRAP, collagen and atherosclerotic plaque Platelet aggregation in blood induced by TRAP (5 μM) activating the PAR-1 receptor was reduced...
- 10
- 441
- 0
báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc
... this article as: Vartanian et al.: LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury Journal of Neuroinflammation ... detrimental effect of TLR signaling is associated with the pathways that lead to NFB activation and pro-inflammatory responses In contrast, TLR signaling pathways that activate IRFs can induce antiinflammatory ... evaluation into the TLR4 signaling cascades revealed a seminal role for the TRIF cascade in producing the neuroprotection initiated by LPS preconditioning As TRIF signaling culminates in IRF3 activation,...
- 12
- 215
- 0
báo cáo hóa học: " Interferon regulatory factor 3 plays an anti-inflammatory role in microglia by activating the PI3K/Akt pathway" doc
... that indicate that the PI3K pathway plays a predominantly anti-inflammatory role in microglial activation It played a particularly potent role in the induction of anti-inflammatory and immunoregulatory ... enhanced by PI3K/Akt presumably by post-transcriptional modification, since mRNA levels did not change Role of PI3K/Akt in astrocyte cytokine production In order to determine whether the anti-inflammatory ... Interferon regulatory factor plays an anti-inflammatory role in microglia by activating the PI3K/Akt pathway Leonid Tarassishin*, Hyeon-Sook Suh, and Sunhee C Lee Departments...
- 50
- 336
- 0
Từ khóa: create a sample xml file from xsdsample testlets released from the aicpatissue cell sample preparation lessons from the antigen retrieval techniquestirring titrate with edta drop by drop until sample color changes from wine red to bthe us federal reserve plays a critical role inthe capital market plays an important role in facilitating the process of economic growth discussthe capital market plays an important role in facilitating the process of economic growthwhat role music plays in our livesthe role music plays in filmthe role music plays in our lifethe role music plays in my lifethe capital market plays an important role in facilitating the process of economic growth in nigeria3mouse model based evidence that nf kappa b plays a pro oncogenic role in hcc sucrose is the primary transport sugar and plays a central role in plant growth and development1 nicotinamide plays a key role in cellular energy metabolismMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ