Sample role plays from ESL role plays

... guests try to get their money back Preparation - Copy / cut role play cards before class Prepare one role play card per hotel owner and one role play card per pair of guests Divide students into groups ... family’s restaurant, but when you graduated from culinary school it closed because of this restaurant You got a job here so you could destroy the restaurant from the inside It’s a...

Ngày tải lên: 25/08/2016, 12:56

... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis...

Ngày tải lên: 21/02/2014, 01:21

... 5¢-GATTCTTAGCAGGTTCATCGCCATCT-3¢ 5¢-TGCACACACTTGGACAGAACAC-3¢ 5¢-GCGAAAACCTAGCTTGGGGAAG-3¢ 5¢-TATATAACGTGAAATGGACGC-3¢ 5¢-GAAGCTCTTCAGGAGGCACTTCCT-3¢ 5¢-CAATGGTGGGTACGCAGAGAGGAT-3¢ 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ ... three important phytopathogenic fungi: R solani, Rhizopus nigricans and Phytophthora parasitica var nicotianae The antifungal activity towards R solani was prominent (Fig 4...

Ngày tải lên: 23/03/2014, 03:20

... have used this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, ... of the a1 b1 or a2 b2 contact greatly suppresses the autoxidation rate, particularly of the b chains [8] In the autoxidation reaction of HbO2, as well a...

Ngày tải lên: 31/03/2014, 15:20

... et al MT1-MMP and furin can interact with GRASP55 Overexpression of GRASP55 has been found to increase the amount of complex containing MT1MMP and furin, and the expression of a catalytically inactive ... with a full-length furin cDNA, were permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane c...

Ngày tải lên: 18/02/2014, 04:20

... derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA ... Transit peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75...

Ngày tải lên: 19/02/2014, 07:20

... identical to that of ePAD or AAH53724 (an egg and embryo abundant peptidylarginine deiminase) Mouse cortical granules contain PAD To ascertain if mouse cortical granules contain PAD, antibodies made ... a classical marker for mouse oocyte cortical granules [23] This lead to the conclusion that calreticulin is localized in a population of granules that is distinc...

Ngày tải lên: 05/03/2014, 17:20

... single cysteine mutations, and demonstrated that this helix plays a prominent role in the coupling process in ABCB1 [25–28] A number of mutations in TM6 caused alterations in drug- stimulated ATP ... Catalytic intermediate CM BM FM Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP...

Ngày tải lên: 06/03/2014, 22:21

... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... 5579 fad49 plays a crucial role in adipogenesis T Hishida et al Fig Characterization of the PX domain of FAD49 (A) Phosphoinositide binding specificity of the...

Ngày tải lên: 16/03/2014, 04:20

... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-...

Ngày tải lên: 16/03/2014, 14:20

Ngày tải lên: 21/03/2014, 22:01

... carried out in duplicate isolated and incubated in the same way as the experiments with MonoMac cells (Fig 3) In addition to TNF -a, the in ammatory cytokine IL-6 was also measured to check that ... LPCAT may alter the cell membrane lipid environment so as to favor the assembly of a signaling complex which can then activate the cellular response [15] To elucid...

Ngày tải lên: 31/03/2014, 01:20

... was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was determined by impedance ... than aspirin in inhibiting the effect of ADP on platelets in blood and (2) NSC23766 inhibits a- granule secretion and platelet aggregation stimulated by ADP ind...

Ngày tải lên: 18/06/2014, 16:20

... this article as: Vartanian et al.: LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury Journal of Neuroinflammation ... detrimental effect of TLR signaling is associated with the pathways that lead to NFB activation and pro-inflammatory responses In contrast, TLR si...

Ngày tải lên: 19/06/2014, 22:20

... that indicate that the PI3K pathway plays a predominantly anti-inflammatory role in microglial activation It played a particularly potent role in the induction of anti-inflammatory and immunoregulatory ... enhanced by PI3K/Akt presumably by post-transcriptional modification, since mRNA levels did not change Role of PI3K/Akt in astrocyte cytokine production In o...

Ngày tải lên: 19/06/2014, 22:20