... typical of fi -chitin) The spectrum of chitin from Fusarium oxysporum was different from the rest Thus, the relative intensity of the bands between 2968 and 2850 cm-’ was different from those of the ... Meyers and K S Lee, Isolation and characterization of chitin from crawfish shell waste J Agric Food Chem 37, 575 (1989) P V Kamasatri and P V Prabhu, Preparatio...
Ngày tải lên: 24/08/2016, 16:11
... [10], and Porphyromonas gingivalis [11], parasitic protozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsis thaliana [14] MGL has been implicated in the ... individual isotypes as well as the significance of their redundancy remain to be elucidated Entamoeba histolytica, a causative agent of amoebiasis, affects an estimated...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx
... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efficient in the stimulation of cAMP productio...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx
... of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered on the top ... indicating that Rv1399c is composed of 22% of a- helices, 25% of b-strand and 39% of random coil The catalytic triad is located at the bottom of a s...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: Characterization of c-tocopherol methyltransferases from Capsicum annuum L and Arabidopsis thaliana pptx
... analysis of methyltransferases have revealed sequential as well as ping-pong mechanisms [31–33] Two closely related methyltransferases involved in the biosynthesis of isoquinoline alkaloids displayed ... with the molecular mass of c-TMT from A thaliana (Fig 4B) The presence of only one labelled band is also indicative that the highly aggregated form of c-TMT observed during...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Comparative biochemical characterization of nitrile-forming proteins from plants and insects that alter myrosinase-catalysed hydrolysis of glucosinolatesk docx
... M Burow et al Nitrile-forming proteins from plants and insects Table Biochemical characteristics of ESP The effects of variable temperature, phosphate ions, radical scavengers, and reducing agents ... thaliana ESP and P rapae NSP alter the outcome of myrosinase-catalysed glucosinolate hydrolysis, this comparative biochemical characterization revealed a numbe...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt
... was 0.7 and overall G-factor, a measure of the normality of the structure, was 0.0 Fig SDS/PAGE and activity analysis of recombinant cellobiohydrolase (A) SDS/ PAGE [10% (w/v) gel] analysis of ... (1985) Isolation and characterization of the endoglucanases of Talaromyces emersonii Biochem J 225, 365–374 29 McHale, A & Coughlan, M (1988) Purification of beta...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx
... for the Ndh membrane subcomplex The Ndh antibodies recognized the 46, 28, 18 and 12 kDa polypeptides, corresponding to the NdhH, -K, -J and -E subunits of the Ndh complex The intact Ndh complex, ... et al of the ndh genes is much higher in BS chloroplasts, and elevated amounts of the Ndh complex have been found in these plastids [18] The functio...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferfish (Tetraodon fluviatilis) ppt
... mut STAT5 AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGACTTCCCAA GAACA CCGCTGTTGCTCAATCGACTAGCCAA GAACA GCCGTGTAGTTTCTTGGAAATTTCTGG GCCGTGTAGTTTAGATTAAATTTCTGG mut STAT6 Int16 ... CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG STAT3 mut STAT3 GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC STAT4 mut STAT4 GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo hóa học: " Detection and characterization of chicken anemia virus from commercial broiler breeder chickens" pdf
... we report detection of CAV and characterization of isolates based on sequence and phylogenetic analysis of partial VP1 gene from commercial broiler breeder chickens in Malaysia Level of transmission ... ESM from eggs collected from commercial broiler breeder farms Figure Detection of CAV DNA in pooled embryonic tissues and ESM from eggs collected fro...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx
... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Preparation and Characterization of Nano structured Materials from Fly Ash: A Waste from Thermal Power Stations, by High Energy Ball Milling" potx
... photomicrographs of fresh and modified fly ash (A and B) SEM of fresh fly ash at 1,000 and 2,500 times magnification, (C and D) SEM of ball milled fly ash for 20 h at 1,000 and 3,000 times magnification, (E and ... 10:1 ratio of balls to fly ash and milling chamber and balls were of tungsten carbide, the ball diameter was 10 mm Toluene was used as the medium with an an...
Ngày tải lên: 22/06/2014, 18:20
Báo cáo khoa học: "Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods" pdf
... M and Collins, M D Molecular taxonomic Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis 223 studies on Streptococcus uberis types I and ... profile using the restriction enzymes RsaI and AvaII RFLP analysis of the 16S rRNA gene had Identification and epidemiological characterization of Strept...
Ngày tải lên: 07/08/2014, 17:22