... association between the measurements of patella tilting and the measurements of femoral, tibial rotation, or femoral rotation relative to tibia, and to trace whether the different patella tilt angle measurements ... Figure the knee Measurements of PTAs and the neighboring bone rotation of Measurements of PTAs and the neighboring bone ro...
Ngày tải lên: 20/06/2014, 01:20
... Regular exercise training improved physical fitness and was effective and safe in mitigating changes associated with lipodystrophy and dyslipidemia in a woman infected with HIV These preliminary ... people of all races who are HIV-positive Case presentation A 31-year-old Latin-American Caucasian woman infected with HIV through a heterosexual relationship with a p...
Ngày tải lên: 10/08/2014, 23:20
EFFECT OF CARBON TO NITROGEN RATIO ON THE COMPOSTING OF CASSAVA PULP WITH SWINE MANURE
... in total organic carbon concentration resulted from the oxidation of carbon to carbon dioxide by microorganisms during composting (Tiquia et al., 1996) Throughout the composting process, total ... 77 84 Composting time (day) Figure Changes in moisture content during composting of cassava pulp with swine manure Total organic carbon and total nitrogen Durin...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc
... membrane Interactions between VVA1 and VVA2 B Fig Effects of volvatoxin A1 (VVA1) on the hemolytic and cytotoxic activity of volvatoxin A2 (VVA2) (A) The hemolytic activity of VVA2 regulated by VVA1 ... VVA2 can use VVA1 as a basis for the formation of VVA2 oligomers Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites in VVA1 respo...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Coordination chemistry of iron(III)±porphyrin±antibody complexes In¯uence on the peroxidase activity of the axial coordination of an imidazole on the iron atom ppt
... a monoclonal anti-porphyrin Ig, with an iron( III)-DoCPP cofactor and imidazole as an axial ligand of the iron which, respectively, mimick the heme cofactor and the axial histidine ligand of the ... Binding of imidazoles to the iron( III) of Fe(ToCPP) and Fe(ToCPP))13G10 The second part of our results concerns the binding of imidazole derivatives on...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf
... representing the strongest effect on the 11bhydroxylation activity of all single mutants investigated here When both mutations were introduced into CYP11B2, the 11b-hydroxylation capacity was additionally ... strongly improve the substrate conversion in relation to the CYP11B2 wild-type protein (Fig 3) By replacing the amino acids in positions 112 and 147 of CYP1...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx
... xCTBP/xALDH1 There are many reports of the inhibitory effects of thyroid hormones upon the activity of several dehydrogenases: pig heart malic dehydrogenase [34], beef liver glutamic dehydrogenase ... flavopiridol-binding protein FEBS Lett 454, 100–104 22 Yamauchi, K & Tata, J.R (2001) Characterization of Xenopus cytosolic thyroid- hormone-binding protein (xCTB...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx
... Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment Journal of Translational Medicine 2010 ... of 13 Figure Determination of transforming growth factor-b, interleukin-10 and autoantibody in interferon-a 2b- treated patients with mel...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " The effects of high frequency subthalamic stimulation on balance performance and fear of falling in patients with Parkinson''''s disease" docx
... STN stimulation In the present study, the patients rated their fear of falling as less severe with the STN stimulation turned ON which supports the improvements found in the majority of the clinical ... Discussion The main finding of this study is that STN stimulation alone improves clinical performance tests that mimic activities of daily living,...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Effects of unilateral robotic limb loading on gait characteristics in subjects with chronic stroke" docx
... Regnaux JP, Pradon D, Roche N, Robertson J, Bussel B, Dobkin B: Effects of loading the unaffected limb for one session of locomotor training on laboratory measures of gait in stroke Clin Biomech (Bristol, ... friction of unpowered ankle robot on gait parameters, interlimb symmetry, and lower extremity joint kinematics in chronic stroke survivors We examined these...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " The effects of powered ankle-foot orthoses on joint kinematics and muscle activation during walking in individuals with incomplete spinal cord injury" pptx
... given to the subject to help with the timing of the pushbutton activation during the patient-controlled conditions This was done by using verbal cues (eg "now", "now") to help them find an appropriate ... subjects with incomplete spinal cord injury walking at 0.54 m/s wearing the orthoses powered under pushbutton control by a therapist (therapist-controlled or...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" Pain in cancer. An outcome research project to evaluate the epidemiology, the quality and the effects of pain treatment in cancer patients" pptx
... http://www.hqlo.com/content/4/1/7 variance to analyze and separate the effects of treatments and time and test the interaction between the two, as well [33] worst and average pain score of ≥ points (pain intensity difference, ... order to be able to conduct and monitor the progress of the trial for the patients' safety and according to the World Me...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo hóa học: "An Analysis of ISAR Image Distortion Based on the Phase Modulation Effect" pptx
... linkage, connecting the distortion introduced in the ISAR image to a time modulation effect in the phase of the scatterer This illustration provides another perspective on the phase modulation effect ... direction The distortion mechanism can be viewed as a phase modulation effect in the phase of the target echo The conventional quadratic phase d...
Ngày tải lên: 22/06/2014, 23:20
Báo cáo lâm nghiệp: "Habitat distribution of dipterocarp species in the Leyte Cordillera: an indicator for species – site suitability in local reforestation programs" ppt
... shows an inverse trend, showing an increase of individuals with increasing height DISCUSSION The studied part of the Leyte Cordillera harbors at least 28% of the Philippine dipterocarp species and ... and the population structure of these species is analysed 152 G Langenberger Figure Observed elevational range of dipterocarp species in the Leyte Cordil...
Ngày tải lên: 08/08/2014, 00:22