An advanced biomass gasification technology with integrated catalytic hot gas cleaning. Part III: Effects of inorganic species in char on the reforming of tars from wood and agricultural wastes

báo cáo hóa học:" Different effects of femoral and tibial rotation on the different measurements of patella tilting: An axial computed tomography study" doc

... association between the measurements of patella tilting and the measurements of femoral, tibial rotation, or femoral rotation relative to tibia, and to trace whether the different patella tilt angle measurements ... Figure the knee Measurements of PTAs and the neighboring bone rotation of Measurements of PTAs and the neighboring bone rotation of the knee PTA-G: patella tilt angle of Grelsamer; PTA-S: patella ... confounding effect of femoral and tibial rotation Discussion The current study has demonstrated various effects of regional bony alignment on the different measurements of the patellar tilt The...

báo cáo khoa học: " Beneficial effects of physical activity in an HIVinfected woman with lipodystrophy: a case report" ppsx

... Regular exercise training improved physical fitness and was effective and safe in mitigating changes associated with lipodystrophy and dyslipidemia in a woman infected with HIV These preliminary ... people of all races who are HIV-positive Case presentation A 31-year-old Latin-American Caucasian woman infected with HIV through a heterosexual relationship with a partner received treatment at ... al.: Beneficial effects of physical activity in an HIV-infected woman with lipodystrophy: a case report Journal of Medical Case Reports 2011 5:430 Submit your next manuscript to BioMed Central...

EFFECT OF CARBON TO NITROGEN RATIO ON THE COMPOSTING OF CASSAVA PULP WITH SWINE MANURE

... in total organic carbon concentration resulted from the oxidation of carbon to carbon dioxide by microorganisms during composting (Tiquia et al., 1996) Throughout the composting process, total ... 77 84 Composting time (day) Figure Changes in moisture content during composting of cassava pulp with swine manure Total organic carbon and total nitrogen During the composting process, total ... during the composting process could be due to the production of ammonium as a result of the ammonification process (Huang et al., 2004) The pH patterns were concomitant to the previous studies on the...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... membrane Interactions between VVA1 and VVA2 B Fig Effects of volvatoxin A1 (VVA1) on the hemolytic and cytotoxic activity of volvatoxin A2 (VVA2) (A) The hemolytic activity of VVA2 regulated by VVA1 ... VVA2 can use VVA1 as a basis for the formation of VVA2 oligomers Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites in VVA1 responsible for direct interaction with ... competition assay (A) Schematic representation of peptide competitors (B) Binding of volvatoxin A2 (VVA2) to volvatoxin A1 (VVA1) was inhibited by the amphipathic a-helices of VVA1 The VVA2 and VVA1...

Tài liệu Báo cáo khoa học: Coordination chemistry of iron(III)±porphyrin±antibody complexes In¯uence on the peroxidase activity of the axial coordination of an imidazole on the iron atom ppt

... a monoclonal anti-porphyrin Ig, with an iron( III)-DoCPP cofactor and imidazole as an axial ligand of the iron which, respectively, mimick the heme cofactor and the axial histidine ligand of the ... Binding of imidazoles to the iron( III) of Fe(ToCPP) and Fe(ToCPP))13G10 The second part of our results concerns the binding of imidazole derivatives on the iron of Fe(ToCPP) either alone in solution ... binding of ligands on the iron of Fe(porphyrin))13G10 complexes: (A) binding of H2O2 on the iron of 13G10-(Fe(ToCPP), (B) binding of two CN± ligands on the iron of 13G10-(Fe(ToCPP), (C) binding of...

Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf

... representing the strongest effect on the 11bhydroxylation activity of all single mutants investigated here When both mutations were introduced into CYP11B2, the 11b-hydroxylation capacity was additionally ... strongly improve the substrate conversion in relation to the CYP11B2 wild-type protein (Fig 3) By replacing the amino acids in positions 112 and 147 of CYP11B2 with those found in mouse, rat and ... residues of CYP11B2 implicated in the regulation of individual reaction steps Swapping the amino acid at position 147 from CYP11B2 to CYP11B1, led to a stronger increase in the hydroxylation at the...

Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx

... xCTBP/xALDH1 There are many reports of the inhibitory effects of thyroid hormones upon the activity of several dehydrogenases: pig heart malic dehydrogenase [34], beef liver glutamic dehydrogenase ... ﬂavopiridol-binding protein FEBS Lett 454, 100–104 22 Yamauchi, K & Tata, J.R (2001) Characterization of Xenopus cytosolic thyroid- hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity Chem ... heart malate dehydrogenase [37], horse and human alcohol dehydrogenases [38–40] and human aldehyde dehydrogenases [31] These observations raise the possibility of the presence of a dehydrogenasespeciﬁc...

Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx

... Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment Journal of Translational Medicine 2010 ... of 13 Figure Determination of transforming growth factor-b, interleukin-10 and autoantibody in interferon-a 2b- treated patients with melanoma (A) Transforming growth factor-b (TGF-b), (B) interleukin ... subjects (P = 0.001) Figure 2B shows the Treg basal level distribution in the 20 healthy donors and by stage in the 44 patients with melanoma (22 patients treated in this study and the other 22 patients...

báo cáo hóa học: " The effects of high frequency subthalamic stimulation on balance performance and fear of falling in patients with Parkinson''''s disease" docx

... STN stimulation In the present study, the patients rated their fear of falling as less severe with the STN stimulation turned ON which supports the improvements found in the majority of the clinical ... Discussion The main finding of this study is that STN stimulation alone improves clinical performance tests that mimic activities of daily living, and that it decreases the patients' fear of falling These ... overnight withdrawal of anti-PD medication and by turning the stimulation OFF and ON respectively STN stimulation alone has been shown to improve the results of the Berg Balance Scale (BBS) [13] and the...

báo cáo hóa học: " Effects of unilateral robotic limb loading on gait characteristics in subjects with chronic stroke" docx

... Regnaux JP, Pradon D, Roche N, Robertson J, Bussel B, Dobkin B: Effects of loading the unaffected limb for one session of locomotor training on laboratory measures of gait in stroke Clin Biomech (Bristol, ... friction of unpowered ankle robot on gait parameters, interlimb symmetry, and lower extremity joint kinematics in chronic stroke survivors We examined these effects in two common rehabilitation ... reduced plantarflexion at toe off of the weighted limb [22] Since individuals with hemiparesis have asymmetric gait, the addition of asymmetric loading to the paretic limb may further increase asymmetry...

báo cáo hóa học: " The effects of powered ankle-foot orthoses on joint kinematics and muscle activation during walking in individuals with incomplete spinal cord injury" pptx

... given to the subject to help with the timing of the pushbutton activation during the patient-controlled conditions This was done by using verbal cues (eg "now", "now") to help them find an appropriate ... subjects with incomplete spinal cord injury walking at 0.54 m/s wearing the orthoses powered under pushbutton control by a therapist (therapist-controlled orthoses) and powered under pushbutton control ... kinematics of two subjects with incomplete spinal cord injury who walked wearing orthoses powered under pushbutton control by a therapist (TC) and wearing orthoses powered under pushbutton control...

báo cáo hóa học:" Pain in cancer. An outcome research project to evaluate the epidemiology, the quality and the effects of pain treatment in cancer patients" pptx

... http://www.hqlo.com/content/4/1/7 variance to analyze and separate the effects of treatments and time and test the interaction between the two, as well [33] worst and average pain score of ≥ points (pain intensity difference, ... order to be able to conduct and monitor the progress of the trial for the patients' safety and according to the World Medical Association Declaration of Helsinki and the European and Italian Good ... history including past cancer history, b) physical examination, c) recording of medications and recent therapies, including analgesic consumption, d) pain assessment using the BPI, e) symptoms and...

Báo cáo hóa học: "An Analysis of ISAR Image Distortion Based on the Phase Modulation Effect" pptx

... linkage, connecting the distortion introduced in the ISAR image to a time modulation eﬀect in the phase of the scatterer This illustration provides another perspective on the phase modulation effect ... direction The distortion mechanism can be viewed as a phase modulation eﬀect in the phase of the target echo The conventional quadratic phase distortion is a result of nonlinear Doppler motion from ... displacement of the scatterer as a result of the rotational motion of the target; ω is the rotational vector from the resultant angular motion of the target and r is the positional vector of the scatterer...

Báo cáo lâm nghiệp: "Habitat distribution of dipterocarp species in the Leyte Cordillera: an indicator for species – site suitability in local reforestation programs" ppt

... shows an inverse trend, showing an increase of individuals with increasing height DISCUSSION The studied part of the Leyte Cordillera harbors at least 28% of the Philippine dipterocarp species and ... and the population structure of these species is analysed 152 G Langenberger Figure Observed elevational range of dipterocarp species in the Leyte Cordillera, at Mt Pangasugan and vicinity, Leyte, ... from the eastern slopes of Mt Pangasugan and the rest of the Leyte Cordillera is desirable When evaluating the species occurrence at lower elevations in the western foothills of Mt Pangasugan, the...

Xem thêm

Từ khóa: evidence of the effects of megavitamin b6 in children diagnosed with autism an interactive machine translation system with online learning an introduction to objectoriented programming with visual basic net download an introduction to objectoriented programming with java solutions manual an introduction to objectoriented programming with java an introduction to objectoriented programming with java pdf an introduction to objectoriented programming with java 5th edition an introduction to objectoriented programming with java pdf wu build an xmlbased content management system with php an introduction to objectoriented programming with java 5th edition pdf free download advanced english vocabulary list with meaning pdf how to create an asp net web page with visual studio 2005 an open source ecg toolkit with dicom advanced english grammar test with answers pdf how to create an asp net web page with visual studio 2008 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ