Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot

Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot

... Team Leader: Dr Tran Xuan Hanh Australian Organisation: Australian Personnel: Australian Animal Health Laboratory (AAHL), PMB 24, Geelong, VIC 3220, Australia Mr Chris Morrissy Date commenced: 01/03/2008 ... culture propagated vaccine CSF vaccine to allow the production of a cheap and high quality vaccine To enhance the diagnostic capability of Vietnamese laboratories to facilitat...

Ngày tải lên: 21/06/2014, 05:20

10 426 0
Báo cáo hóa học: " Research Article Analysis of Transient and Steady-State Behavior of a Multichannel Filtered-x Partial-Error Affine Projection Algorithm" docx

Báo cáo hóa học: " Research Article Analysis of Transient and Steady-State Behavior of a Multichannel Filtered-x Partial-Error Affine Projection Algorithm" docx

... (33) and in (34) provide accurate estimates of the steady-state MSE and of the steady-state A Carini and G L Sicuranza Table 3: First eight coefficients of the MMS solution (wo ) and of the asymptotic ... solution of the FX-PE-AP algorithm and compares it with that of FX-AP algorithms and with the minimum-mean-square solution of the ANC problem Section presents t...

Ngày tải lên: 22/06/2014, 22:20

15 311 0
Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps

Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps

... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison of ... is affected less by a branch of equal thickness, the growth potential has to be integrated in the model to describe the effect of branchiness on tree qualit...

Ngày tải lên: 08/08/2014, 14:22

8 315 1
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot

Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot

... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the ... RTQ -PCR assay These findings suggest that the ultra sensitive RTQ -PCR assay is equally reliable as the Figure Comparison of the HBV-DNA values estimated using COBAS TaqM...

Ngày tải lên: 12/08/2014, 04:20

6 538 1
Báo cáo y học: "Child and Adolescent Psychiatry and Mental Health – development of a new open-access journal" ppt

Báo cáo y học: "Child and Adolescent Psychiatry and Mental Health – development of a new open-access journal" ppt

... Child and Adolescent Psychiatry and Mental Health 2008, 2:22 http://www.capmh.com/content/2/1/22 and all readers We also have a special interest in case reports with reference to cultural backgrounds ... construed as official or as reflecting the views of the Department of Health and Human Services, the National Institutes of Health, or the National Institute of...

Ngày tải lên: 13/08/2014, 18:21

2 180 0
Development of a new elastic path controller for the collaborative wheelchair assistant

Development of a new elastic path controller for the collaborative wheelchair assistant

... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... Research Objectives The primary objective of the present study was to develop a new Elastic Path Controller for the Collaborative Wheelchair Ass...

Ngày tải lên: 11/09/2015, 09:59

160 310 0
Hyperscsi  design and development of a new protocol for storage networking

Hyperscsi design and development of a new protocol for storage networking

... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... volume of and the increasingly critical role played by data storage, there is a strong demand to put data storage on network Therefore, how to share data, improve...

Ngày tải lên: 16/09/2015, 15:54

169 516 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...

Ngày tải lên: 03/04/2013, 21:07

10 782 3
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...

Ngày tải lên: 05/03/2014, 14:20

6 524 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...

Ngày tải lên: 14/03/2014, 13:20

14 402 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...

Ngày tải lên: 15/03/2014, 00:20

15 479 0
w