Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

... Team Leader: Dr Tran Xuan Hanh Australian Organisation: Australian Personnel: Australian Animal Health Laboratory (AAHL), PMB 24, Geelong, VIC 3220, Australia Mr Chris Morrissy Date commenced: 01/03/2008 ... culture propagated vaccine CSF vaccine to allow the production of a cheap and high quality vaccine To enhance the diagnostic capability of Vietnamese laboratories to facilitat...

Ngày tải lên: 21/06/2014, 05:20

... (33) and in (34) provide accurate estimates of the steady-state MSE and of the steady-state A Carini and G L Sicuranza Table 3: First eight coefficients of the MMS solution (wo ) and of the asymptotic ... solution of the FX-PE-AP algorithm and compares it with that of FX-AP algorithms and with the minimum-mean-square solution of the ANC problem Section presents t...

Ngày tải lên: 22/06/2014, 22:20

... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison of ... is affected less by a branch of equal thickness, the growth potential has to be integrated in the model to describe the effect of branchiness on tree qualit...

Ngày tải lên: 08/08/2014, 14:22

... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the ... RTQ -PCR assay These findings suggest that the ultra sensitive RTQ -PCR assay is equally reliable as the Figure Comparison of the HBV-DNA values estimated using COBAS TaqM...

Ngày tải lên: 12/08/2014, 04:20

... Child and Adolescent Psychiatry and Mental Health 2008, 2:22 http://www.capmh.com/content/2/1/22 and all readers We also have a special interest in case reports with reference to cultural backgrounds ... construed as official or as reflecting the views of the Department of Health and Human Services, the National Institutes of Health, or the National Institute of...

Ngày tải lên: 13/08/2014, 18:21

... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... Research Objectives The primary objective of the present study was to develop a new Elastic Path Controller for the Collaborative Wheelchair Ass...

Ngày tải lên: 11/09/2015, 09:59

... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... volume of and the increasingly critical role played by data storage, there is a strong demand to put data storage on network Therefore, how to share data, improve...

Ngày tải lên: 16/09/2015, 15:54

... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...

Ngày tải lên: 03/04/2013, 21:07

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...

Ngày tải lên: 28/10/2013, 11:15

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...

Ngày tải lên: 05/03/2014, 14:20

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...

Ngày tải lên: 14/03/2014, 13:20

... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...

Ngày tải lên: 15/03/2014, 00:20

Ngày tải lên: 15/03/2014, 23:56