Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan
... macromolecules will be influenced by the < /b> presence of < /b> the < /b> other type, when both are present When both the < /b> polysaccharides and < /b> the < /b> proteins gel, synergy between the < /b> two interpenetrating networks may be a useful ... can be found They are included as an appendix to the < /b> thesis -2- Chapter 1: BACKGROUND 1.1 Beta lactoglobulin β -lactoglobuli...
Ngày tải lên: 12/07/2015, 13:00
... or gain -of- function variants of MLL1 are prime examples of the importance of maintaining the enzymatic activity of MLL1 under tight control Identifying the protein structural features that account ... association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 121, 873–885 17 Yokoyama A, Wang Z, Wysocka J, Sa...
Ngày tải lên: 16/02/2014, 14:20
... ª 2007 FEBS 63 The actin binding domain of spinophilin H Schuler and W Peti ¨ Fig Spinophilin F -actin binding domain constructs can crosslink and cap actin polymers Polymers of actin, marked with ... study and domain borders indicated by numbers The core actin binding domain, PP1 binding domain, PDZ domain and C-terminal coiled-coil region are indicated...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx
... subtypes A, C, D and CRF_AE These Tat variants have been synthesized using solid phase synthesis and have been shown to be able to cross membranes and trans-activate the HIV-1 LTR except for Tat ... than the long form [15] In the NMR study of the full-length 99 residue Tat Eli, the C-terminus of Tat masks the α-helix of the glutamine-rich region [38], possibly re...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo khoa học: Structure of the polysaccharide chain of the lipopolysaccharide from Flexibacter maritimus pptx
... was eluted ahead of compound (from LPS), the a- and b-anomers of were not separated under these conditions: Yield of 1, 23 mg from O-PS, 38 mg from LPS; yield of 3, mg from LPS The acetate derivative ... distincta polysaccharide it reflects different configurations of the monosaccharides The A-B-fragment of the O-PS from F maritimus is isosteric to that of P...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa hoc:"Effect of the slow (K) or rapid (k +) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn × brown egg type cross" ppsx
... especially concerning remiges and rectrices At one day of age, the primary and secondary feathers are like coverts in a slow feathering chick, and at eight days they not have tails Owing to the considerable ... Sheridan and Mc Donald [17] according to whom the body and feathers of the chick at weeks of age are in competition for arginin and cystein,...
Ngày tải lên: 09/08/2014, 18:21
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regi...
Ngày tải lên: 14/02/2014, 19:20
Báo cáo khoa học: Solution structure and backbone dynamics of the XPC-binding domain of the human DNA repair protein hHR23B docx
... 2A) The N-terminal part of XPCB hHR23B B C Fig NMR structure of the XPCB domain of hHR23B (A) Stereoview of the 12 superimposed structures of XPCB hHR23B All Pro residues conserved among the ... further our knowledge with respect to the mechanisms of action of these proteins, it is crucial that we define the precise boundaries of the STI1-homologous domai...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc
... pivot about the stable AKAP-bound dimerization and docking domain, and to weakly associate with another part of the molecule, possibly the tandem cAMP binding domains of the regulatory subunit ... secondary, tertiary, and quaternary structure packing and stability In addition, we discuss the role of charges in function of RIIa D/D MATERIALS AND METHODS Sampl...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo khoa học: Refined solution structure and backbone dynamics of the archaeal MC1 protein ppt
... additional DNA and the body of the protein [19] In the case of MC1 DNA complexes, we know that the protein covers at least 15 bp and that the binding site is composed of two areas of contact separated ... inwards, the arms close and the tips of the arms wrap around the DNA The amplitudes and time scales of the intramolecular motions experienced b...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx
... Ao and At are the intensities of the band of intact protein at the beginning of trypsinolysis and at the fixed time of trypsinolysis) against the time of incubation (Fig 8D) The apparent rate constants ... are same as given in (A) Point mutations of the b5–b7 loop of human HSP22 their secondary structure and on superposition of the mammal...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTT...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp7 ) from zebrafish (Danio rerio) potx
... binding protein activator protein activator protein activator protein )3 4 )6 6 )1 26 )2 38 )4 35 )5 22 )7 88 )9 63 )8 77 )9 11 )1 064 )1 47 )1 091 )1 122 )1 203 )1 77 )6 72 )9 40 )2 00 )5 61 )6 60 )7 71 )8 58 )2 10 )5 97 )7 36 ... )6 60 )7 71 )8 58 )2 10 )5 97 )7 36 )9 29 ( ) ( )...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: Structure, linkage mapping and expression of the heart-type fatty acid-binding protein gene (fabp3 ) from zebrafish (Danio rerio) pot
... )2 97 )8 91 )3 33 )6 35 )6 71 )8 89 )3 63 )9 55 )7 60 )9 74 )1 099 )1 082 )1 198 ( +) ( +) ( ) ( ) ( +) ( ) ( +) ( +) ( +) ( ) ( +) ( ) ( ) ( ) ( ) ( +) ( +) 1.000 0.976 0.881 1.000 1.000 0.806 1.000 1.000 1.000 1.000 ... Denovan-Wright, E.M & Wright, J.M (200 3) Structure, mRNA expression and...
Ngày tải lên: 31/03/2014, 07:20