A text analysis of “the 2007 commencement speech by bill gates at harvard university ” and “the 2014 commencement speech by bill and melinda gates at stanford university” on the de beaugrande framework

The lender of last resort a critical analysis of the federal reserve’s unprecedented intervention after 2007

The lender of last resort a critical analysis of the federal reserve’s unprecedented intervention after 2007

... them.) The high rate has the advantage of encouraging retention of the stock of the gold component of the monetary base at home as well as attracting additions to that stock from abroad And the ... Historical Federal Reserve data also are available on the FRED website maintained by the Federal Reserve Bank of St Louis See, also, a March 1936 pamphlet published...

Ngày tải lên: 23/09/2015, 08:53

101 287 0
A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

... expressed via the modal verbs can, may, must in English and the equivalent expressions in Vietnamese Aims of the study This study - A contrastive analysis of the meanings expressed via the modals can, ... contrastive analysis of the meanings expressed via the modal verbs can, may, must and the equivalent...

Ngày tải lên: 29/01/2014, 00:23

56 2.6K 19
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... phase contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline ... at each phase of the cell cycle were estimated from their DNA content histograms after drug treatment Apoptosis was quantified and Fig Effects of daunorubicin and...

Ngày tải lên: 20/02/2014, 23:20

7 581 0
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc

Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc

... grassland) Figure shows the regional breakout of the potential carbon dioxide equivalent sequestered through afforestation on cropland and pastureland and through soil management at a carbon price ... a regional model of the U.S agricultural sector, Lewandrowski et al examined the potential for carbon sequestration at various carbon prices At a carbon price of $34 per MT...

Ngày tải lên: 21/02/2014, 01:20

13 651 0
A Text-Book of the History of Architecture Seventh Edition, revised pdf

A Text-Book of the History of Architecture Seventh Edition, revised pdf

... the arrangement of the points of support, and hence the nature of the structural design A comparison, for example, of the plans of the Hypostyle Hall at Karnak (Fig 11, h) and of the Basilica ... the North and West, meanwhile, under the growing institutions of the papacy and of the monastic orders and the emergence of a feudal civilization out of...

Ngày tải lên: 05/03/2014, 14:20

25 499 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC ... TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA Change Change Change Change Change Chang...

Ngày tải lên: 16/03/2014, 03:20

14 477 0
Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf

Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf

... consumed at a time and the total number consumed Our assumption can be viewed as an approximation of such a convex function Jain: Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision ... consumption occasion We find that the basic nature of the results hold even in this alternate formulation Jain: Marketing of Vice Goods: A...

Ngày tải lên: 16/03/2014, 11:20

16 488 0
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx

A Comparative Analysis of the Financing of HIV/AIDS Programmes docx

... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... The financing of HIV/AIDS programmes Most of the National Integrated Programme funds are made available to the three Departments at the provincial level and split betw...

Ngày tải lên: 22/03/2014, 18:20

63 312 0
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx

Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx

... same channel allocations as existing legacy narrowband analog FM two-way radios To facilitate a gradual transition to the system, P25-compliant radios must be capable of demodulating legacy analog ... sensitive traffic and that allow an active attacker remarkable leverage At the root of many of the most important practical vulnerabilities in P25 systems are a number of fun...

Ngày tải lên: 23/03/2014, 13:20

16 1.2K 0
Who Pays? A Distributional Analysis of the Tax Systems in All 50 States docx

Who Pays? A Distributional Analysis of the Tax Systems in All 50 States docx

... permanently increased their state sales tax rate Arizona, Arkansas, California, Hawaii, Kansas, and Nevada all temporarily increased the sales tax Other Notable Changes • A dozen states either adopted ... Distributional Analysis of the Tax Systems in All 50 States, 4th Edition Food in Base            12 Sales taxes are usually calculated as a perc...

Ngày tải lên: 23/03/2014, 20:20

135 1.5K 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

... The Rise and Fall of the U.S Mortgage and Credit Markets A Comprehensive Analysis of the Meltdown James R Barth, Tong Li, Wenling Lu, Triphon Phumiwasana, and Glenn Yago January 2009 A full-length ... financial crisis, along with policy recommendations for moving forward The Rise and Fall of the U.S Mortgage and Credit Markets: A Compre...

Ngày tải lên: 29/03/2014, 07:20

51 467 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... gene signaling pathway analysis has identified gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also up-regulated in whole liver Therefore, the microarray analysis ... protocol, and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray...

Ngày tải lên: 30/03/2014, 04:20

14 597 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes doc

A Comparative Analysis of the Financing of HIV_AIDS Programmes doc

... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... The financing of HIV/AIDS programmes Most of the National Integrated Programme funds are made available to the three Departments at the provincial level and split between...

Ngày tải lên: 30/03/2014, 07:20

63 322 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes potx

A Comparative Analysis of the Financing of HIV_AIDS Programmes potx

... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... The financing of HIV/AIDS programmes Most of the National Integrated Programme funds are made available to the three Departments at the provincial level and split between...

Ngày tải lên: 30/03/2014, 07:20

63 328 0
a comparative analysis of the cognitive moral development of independent public auditors in selected public accounting firms and bank examiners in selected federal banking regulatory agencies

a comparative analysis of the cognitive moral development of independent public auditors in selected public accounting firms and bank examiners in selected federal banking regulatory agencies

... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproductio...

Ngày tải lên: 03/06/2014, 02:11

143 441 0
w