... mice lacking both DAP12 and FcRc DAP1 2–/ – FcRc– /– double and Syk– /– single mutant bone marrow cells failed to differentiate into mature osteoclasts and did not resorb bone DAP12 and FcRc were constitutively ... Phosphorylation of DAP12 and FcRc was defective in cells lacking Src-family kinases, and the phosphorylation of Syk was absent both in Src-family deficient an...
Ngày tải lên: 16/03/2014, 22:20
... Plant VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO GMC GMC GMC Succinate dehydrogenase Succinate dehydrogenase DAAO DAAO DAAO DAAO ? ? VAO AMO AMO DAAO DAAO ... incubated On the role and formation of covalently bound flavin cofactors with 8-Cl-FAD (FAD is linked via an 8-carbon rather than an 8a- carbon linkage) The covalent incorporatio...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: On peptide bond formation, translocation, nascent protein progression and the regulatory properties of ribosomes ppt
... linkage on the severe restriction of the space available for the passage of nascent proteins through the tunnel by the swung conformation of L22; on the conservation of the L22 double-hook; and on the ... functional relevance Analysis of the properties of this region illuminated a unified mechanism for the formation of the peptide bond, the...
Ngày tải lên: 23/03/2014, 17:22
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf
... replicated with a delay of approximately days compared to the wt virus Replication of the Q591L mutant was significantly better, with a delay of only one day compared to the wt virus Of note is that ... (see the text) was passaged onto × 106 fresh MT-2 T cells in the presence or absence of 0.3 mM BME and virus spread was measured for 10 days the rate of appea...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... calculated and reported, such as the average a4v in each hot-spot, the area of the aggregation profile above the HST, the total area (the HST being the zero axis) and the area above the HST of each ... set of 23 well-known amyloidogenic proteins and (c) guidance towards applying this software as a useful tool for improving the solubility of recombinant pr...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
... enzymatic assays using human and porcine P450c17 in the presence of various substrates – preg, 17aOHpreg and DHEA – and analyzed androstadienol formation from each substrate As observed in Fig ... its activity increasing to 15% of preg transformation while the activity of human P450c17 increases to 12% These results show that human and porcine P450c17 hav...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Bacitracin inhibits the reductive activity of protein disulfide isomerase by disulfide bond formation with free cysteines in the substrate-binding domain pptx
... form of bacitracin to free cysteines in the substrate-binding domain of PDI However, the interaction between bacitracin and PDI is nonspecific, and applies to other proteins containing free cysteines ... catalysis in the presence of bacitracin These findings can be explained by our results showing that bacitracin targets the substratebinding domain of...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Stability and fibril formation properties of human and fish transthyretin, and of the Escherichia coli transthyretin-related protein potx
... by DSC to be the Tm of the protein These fibrils are amyloidogenic, as determined from their Stability and fibril formation of TTR and TRP tinctorial properties in the ThT-binding and CR-binding ... with the thermostability of its tetrameric and monomeric structures Thermostability and protein structures We have analyzed the structures of hTTR (Protein...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into t...
Ngày tải lên: 16/03/2014, 05:20
Formation of silicon oxide nanowires directly from au si and pd–au si substrates
... atomic ratio of Si/ O in the SiOx nanowires on the Pd Au/ Si substrate is nearly consistent with the of SiO2 An efficient diffusion path for Si in the Pd Au alloy may result from the formation of many ... structure consisting of Pd surrounded by Au facilitates the formation of nanowires Fig shows FE-SEM images revealing the general morphologies of SiOx nanowires...
Ngày tải lên: 16/03/2014, 15:16
Báo cáo khoa học: Kinetics of intra- and intermolecular zymogen activation with formation of an enzyme–zymogen complex ppt
... mechanisms of autocatalytic zymogen activation and has been sufficiently justified [11,29–31] Previously, kinetic analyses of the reactions, whereby a zymogen is activated both intra- and intermolecularly ... for each of these mechanisms with the experimental results, these authors suggested a reaction mechanism including both intra- and intermolecular activation of...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo Y học: Disul®de bond formation through Cys186 facilitates functionally relevant dimerization of trimeric hyaluronan-binding protein 1 (HABP1)/p32/gC1qR docx
... Biotinylation of hyaluronan, D-mannosylated BSA and HABP1, and their use in binding assays Hyaluronan was biotinylated by the procedure of Yang et al [ 31] HABP1 and the polypeptide backbone of mannosylated ... with HABP1 (synonyms C1QBP, gC1qR, p32 and HABP1), reveals that the peptide segment K 119 to K128 of each monomer in a trimeric assembly is usually accessible to the solvent...
Ngày tải lên: 17/03/2014, 17:20
The formation of the plural noun in English and Vietnamese equivalents
... compare the differences between the formation of plural nouns in English and in Vietnamese 36 Chapter two :The formation of plural nouns in English and Vietnamese equivalents In English, the English ... reference books and on the internet to select the valuable information relating to the theme the forming of the plural nouns in E...
Ngày tải lên: 19/03/2014, 17:10
Báo cáo khoa học: Hatching enzyme of the ovoviviparous black rockfish Sebastes schlegelii – environmental adaptation of the hatching enzyme and evolutionary aspects of formation of the pseudogene docx
... Scorpaeniformes within the Euteleostei [15] The hatching enzyme was identified from ovarian fluids of the black rockfish, and the cDNAs and the genes for the hatching enzyme were cloned from the embryos Results ... secreted from hatching gland cells to digest the chorion In this study, we observed the embryo hatching of the ovoviviparous black rock...
Ngày tải lên: 23/03/2014, 07:20