Structural damage assessment of building structures using dynamic experimental data (p 1 8)
... value 11 12 13 14 15 16 17 18 19 10 20 1 004 1 032 1 0 1 0 0·799 1 015 0·8 1 0 0·9 91 1 13 5 1 0 1 0 0·993 1 006 1 0 1 0 0·997 1 026 1 0 1 0 0·986 1 055 1 0 1 0 0·9 81 1·000 1 0 1 0 0·999 0·998 1 0 1 0 ... 0·9 71 0·986 1 0 1 0 1 003 0·999 1 0 1 0 0·993 1 003 1 0 1 0 0·996 0·986 1 0 1 0 0·999 0·999 1 0 1 0 0·999 0·995 1 0 1 0 1 000 1 003 1 0...
Ngày tải lên: 17/06/2016, 14:10
... the buildings It is the new way to design the smart buildings with light weight by incorporating the PCMs inside the hollow cavity of brick Environment Friendly Cooling of building using phase change ... benefits remain uncertain, especially for the residential sector This study investigates the potential of using PCM for thermal heat storage in building facade...
Ngày tải lên: 05/09/2013, 17:03
... 92.50 92.32 Table 3: Tagging accuracies of all tokens (in %) Models D and G indicate domain-specific and generalized models, respectively and Model S indicates the dynamic model selection approach ... The dynamic model selection approach (Model S) shows the most robust results across genres, although Models D and G still can perform Some semi-supervised and domain-adap...
Ngày tải lên: 19/02/2014, 19:20
Health and Wealth of Elderly Couples: Causality Tests Using Dynamic Panel Data Models pot
... ABSTRACT Health and Wealth of Elderly Couples: Causality Tests Using Dynamic Panel Data Models A positive relationship between socio-economic status (SES) and health, the so-called "health- wealth ... Health and Wealth of Elderly Couples: Causality Tests Using Dynamic Panel Data Models Pierre-Carl Michaud CentER, Tilburg University and...
Ngày tải lên: 05/03/2014, 18:20
Báo cáo hóa học: " Research Article Automated Intelligibility Assessment of Pathological Speech Using Phonological Features" potx
... L Shriberg, and J R Green, “Diagnostic assessment of childhood apraxia of speech using automatic speech recognition (ASR) methods,” Journal of Medical SpeechLanguage Pathology, vol 12, no 4, ... “Automatic scoring of the intelligibility in patients with cancer of the oral cavity,” in Proceedings of the 8th Annual Conference of the International Speech Communication A...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo lâm nghiệp: " Fungi associated with Tomicus piniperda in Poland and assessment of their virulence using Scots pine seedlings" doc
... above Fungi associated with Tomicus piniperda in Poland 803 Table I The results of the inoculation experiments with fungi associated with Tomicus piniperda on two-year-old plants Depth of sapwood ... associated with T piniperda was investigated by inoculating Scots pine seedlings MATERIALS AND METHODS In Mielec, 24 uninfested Scots pine trees we...
Ngày tải lên: 07/08/2014, 16:20
liquefaction mitigation of silty soils using dynamic compaction
... has been developed for liquefaction mitigation of loose sand and non-plastic silty soils The design model has been used to determine the densification achievable using DC in silty deposits supplemented ... expected to advance the use of DC for liquefaction mitigation of silty soils, and reduce the reliance on empirical equations and expensive field trials 1.3 Outline...
Ngày tải lên: 13/11/2014, 16:21
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied ... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian L...
Ngày tải lên: 15/05/2015, 00:37
Uncertainty and imprecision in safety assessment of offshore structures
... uncertainty and Chapter Introduction imprecision 1.2 Modeling of Uncertainty and Imprecision The distinction between uncertainty and imprecision in Section1.1 helps to avoid inappropriate modeling of ... realistic modeling and an adequate processing of the available information regarding marine corrosion and marine growth effects through the safety assessment...
Ngày tải lên: 10/09/2015, 08:39
Substructural identification with incomplete measurement for structural damage assessment
... SUBSTRUCTURAL IDENTIFICATION WITH INCOMPLETE MEASUREMENT FOR STRUCTURAL DAMAGE ASSESSMENT TEE KONG FAH B.Eng (Hons.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Concluding Remarks 134 CHAPTER 5: Substructural Identification of Large Structures with Incomplete Measurement 149 5.1 General Remarks 149 5.2 Combination with CMIR and Substructural Approach 1...
Ngày tải lên: 16/09/2015, 17:12
EM modelling of periodic structures using greens functions
... EM MODELLING OF PERIODIC STRUCTURES USING GREEN’S FUNCTIONS ZHANG HONGXUAN (B.S., Tianjin University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF ELECTRICAL ... coupled system of Helmholtz equations can be reformulated using the vector form of the Helmholtz-Kirchoff integral theorem in terms of a coupled system of boundary integral eq...
Ngày tải lên: 05/10/2015, 19:05
Debris flow impact assessment along the AlRaith Road, Kingdom of Saudi Arabia, using remote sensing data and field investigations
... cut and damaged the road The current research aims to evaluate the debris flow assessment along this highway using remote sensing data and field studies According to the detailed analysis of geological ... considered to stop the debris flows, and stabilizing slopes included starving the potential flow of the water and6 or starving the flow o...
Ngày tải lên: 25/04/2016, 07:25
Báo cáo hóa học: "Research Article The Effect of Cooperation on Localization Systems Using UWB Experimental Data" doc
... deviation of the ranging error for each condition, as well as the frequency of the condition (number of configurations belonging to the condition over the total number of configurations considered) The ... estimates the ranges to these beacons, from which it determines its position The accuracy of rangeonly localization systems depends mainly on two factors The...
Ngày tải lên: 21/06/2014, 22:20
Interval mapping of human QTL using sib pair data
... statistic in multiple QTL mapping and the generalized linear model for interval mapping 16 Chapter 2: Interval Mapping of QTL in Human Chapter Interval Mapping of QTL in Human 2.1 Haseman-Elston ... 2: Interval Mapping of QTL in Human 2.2 Estimation of the proportion of alleles IBD shared at a QTL by a sib pair using the information in flankin...
Ngày tải lên: 14/09/2015, 18:36
Báo cáo khoa học: Maturation of Pichia pastoris-derived recombinant pro-Der p 1 induced by deglycosylation and by the natural cysteine protease Der p 1 from house dust mite doc
... 2, rpro -Der p (X-33); lane 3, Endo H-treated rpro -Der p (X-33); lane 4, rpro -Der p (SMD 116 8h); lane 5, rpro -Der p Endo H-treated (SMD 116 8h); lane 6, rpro -Der p (GS 115 ); lane 7, rpro -Der p Endo ... nDer p (C) Lane 1, rpro -Der p (X-33); lane 2, rpro -Der p 1( SMD 116 8h); lane 3, Endo H-treated rpro -Der p 1; lane 4, nDer p 1; lane 5, prestained,...
Ngày tải lên: 17/03/2014, 11:20