Structural damage assessment of building structures using dynamic experimental data (p 1 8)

... value 11 12 13 14 15 16 17 18 19 10 20 1 004 1 032 1 0 1 0 0·799 1 015 0·8 1 0 0·9 91 1 13 5 1 0 1 0 0·993 1 006 1 0 1 0 0·997 1 026 1 0 1 0 0·986 1 055 1 0 1 0 0·9 81 1·000 1 0 1 0 0·999 0·998 1 0 1 0 ... 0·9 71 0·986 1 0 1 0 1 003 0·999 1 0 1 0 0·993 1 003 1 0 1 0 0·996 0·986 1 0 1 0 0·999 0·999 1 0 1 0 0·999 0·995 1 0 1 0 1 000 1 003 1 0 1 0 1 008 1 013 1 0 1 0 1 018 1 000 1 0 1 0 1 009 1 002 1 0 ... 0·998 1 0 1 0 1 080 0·979 1 0 1 0 1 002 0·9 91 1·0 1 0 1 000 1 023 1 0 1 0 1 002 1 008 1 0 1 0 1 0 01 1·000 1 0 1 0 0·999 1 016 1 0 1 0 0· 811 0·808 0·8 0·8 0·998 0·999 1 0 1 0 0·999 0·999 1 0 1 0...

Experimental study of passive cooling of building facade using phase change materials to increase thermal comfort in buildings in hot humid areas

... the buildings It is the new way to design the smart buildings with light weight by incorporating the PCMs inside the hollow cavity of brick Environment Friendly Cooling of building using phase change ... benefits remain uncertain, especially for the residential sector This study investigates the potential of using PCM for thermal heat storage in building facades in hot humid climates This integration ... resulting in rapid swings of internal temperature Optimized selection of building materials for making the external envelop also plays an important role in achieving thermal comfort in buildings, ...

Tài liệu Báo cáo khoa học: "Fast and Robust Part-of-Speech Tagging Using Dynamic Model Selection" pptx

... 92.50 92.32 Table 3: Tagging accuracies of all tokens (in %) Models D and G indicate domain-speciﬁc and generalized models, respectively and Model S indicates the dynamic model selection approach ... The dynamic model selection approach (Model S) shows the most robust results across genres, although Models D and G still can perform Some semi-supervised and domain-adaptation approaches using ... POS tagging and model selection tokens / sec Stanford 421 SVMTool 1,163 Model S 31,914 Table 5: Tagging speeds Conclusion We present a dynamic model selection approach that improves the robustness...

Health and Wealth of Elderly Couples: Causality Tests Using Dynamic Panel Data Models pot

... ABSTRACT Health and Wealth of Elderly Couples: Causality Tests Using Dynamic Panel Data Models A positive relationship between socio-economic status (SES) and health, the so-called "health- wealth ... Health and Wealth of Elderly Couples: Causality Tests Using Dynamic Panel Data Models Pierre-Carl Michaud CentER, Tilburg University and IZA Bonn Arthur van Soest RAND Corporation, ... does not cause health, Tables and present the results of models that explain each indicator of health of husband and wife from lagged husband’s and wife’s health, lagged log wealth, and additional...

Báo cáo hóa học: " Research Article Automated Intelligibility Assessment of Pathological Speech Using Phonological Features" potx

... L Shriberg, and J R Green, “Diagnostic assessment of childhood apraxia of speech using automatic speech recognition (ASR) methods,” Journal of Medical SpeechLanguage Pathology, vol 12, no 4, ... “Automatic scoring of the intelligibility in patients with cancer of the oral cavity,” in Proceedings of the 8th Annual Conference of the International Speech Communication Association (Interspeech ’07), ... frames of all utterances of one speaker, the speaker feature extractor can derive from these tuples (and from the canonical values of the phonological classes in the diﬀerent states) a set of phonological...

Báo cáo lâm nghiệp: " Fungi associated with Tomicus piniperda in Poland and assessment of their virulence using Scots pine seedlings" doc

... above Fungi associated with Tomicus piniperda in Poland 803 Table I The results of the inoculation experiments with fungi associated with Tomicus piniperda on two-year-old plants Depth of sapwood ... associated with T piniperda was investigated by inoculating Scots pine seedlings MATERIALS AND METHODS In Mielec, 24 uninfested Scots pine trees were felled in early March In the other sampling locations ... Isolation of > 60 species of fungi from T piniperda galleries in Scots pine demonstrate that this beetle is associated with a great diversity of ﬁlamentous microfungi in Poland Ophiostomatoid fungi...

liquefaction mitigation of silty soils using dynamic compaction

... has been developed for liquefaction mitigation of loose sand and non-plastic silty soils The design model has been used to determine the densification achievable using DC in silty deposits supplemented ... expected to advance the use of DC for liquefaction mitigation of silty soils, and reduce the reliance on empirical equations and expensive field trials 1.3 Outline of dissertation Chapter presents ... the effects of fine contents on penetration resistance of silty sands In appendix B results of past research on energy required to cause liquefaction in sands and non-plastic silty soils are presented...

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied ... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... contributed to the dramatic boost in the distance that larvae moved in the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their...

Uncertainty and imprecision in safety assessment of offshore structures

... uncertainty and Chapter Introduction imprecision 1.2 Modeling of Uncertainty and Imprecision The distinction between uncertainty and imprecision in Section1.1 helps to avoid inappropriate modeling of ... realistic modeling and an adequate processing of the available information regarding marine corrosion and marine growth eﬀects through the safety assessment of oﬀshore structures In view of an appropriate ... UNCERTAINTY AND IMPRECISION IN SAFETY ASSESSMENT OF OFFSHORE STRUCTURES ZHANG MINGQIANG (B.Eng., Tongji Univ.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CIVIL...

Substructural identification with incomplete measurement for structural damage assessment

... SUBSTRUCTURAL IDENTIFICATION WITH INCOMPLETE MEASUREMENT FOR STRUCTURAL DAMAGE ASSESSMENT TEE KONG FAH B.Eng (Hons.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Concluding Remarks 134 CHAPTER 5: Substructural Identification of Large Structures with Incomplete Measurement 149 5.1 General Remarks 149 5.2 Combination with CMIR and Substructural Approach 150 5.3 ... Simulated Column Damage of Laboratory Model 191 6.10 Dynamic Tests and Identification of Damaged Frame 193 6.10.1 Damage Assessment with the CMIR-SEREP Method 193 6.10.2 Damage Assessment with the sub-SOMI-RR...

EM modelling of periodic structures using greens functions

... EM MODELLING OF PERIODIC STRUCTURES USING GREEN’S FUNCTIONS ZHANG HONGXUAN (B.S., Tianjin University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF ELECTRICAL ... coupled system of Helmholtz equations can be reformulated using the vector form of the Helmholtz-Kirchoff integral theorem in terms of a coupled system of boundary integral equations [1.10] Of course, ... This periodic Green’s function can be applied in many EM problems, such as FSS and a large array of antenna elements It will be used in Chapter 2~4 for the EM modelling of various periodic structures...

Debris flow impact assessment along the AlRaith Road, Kingdom of Saudi Arabia, using remote sensing data and field investigations

... cut and damaged the road The current research aims to evaluate the debris flow assessment along this highway using remote sensing data and field studies According to the detailed analysis of geological ... considered to stop the debris flows, and stabilizing slopes included starving the potential flow of the water and6 or starving the flow of the solid elements, intercepting the flow using barriers, ... to understand and analyse the detailed characteristics of the debris flow of these channels and the sources of these debris Additionally, the geomorphic situation of the channels was studied in...

Báo cáo hóa học: "Research Article The Effect of Cooperation on Localization Systems Using UWB Experimental Data" doc

... deviation of the ranging error for each condition, as well as the frequency of the condition (number of conﬁgurations belonging to the condition over the total number of conﬁgurations considered) The ... estimates the ranges to these beacons, from which it determines its position The accuracy of rangeonly localization systems depends mainly on two factors The ﬁrst is the geometric conﬁguration of the ... target locations in the grid Clearly, a pair of devices can be in non-LoS (NLoS) condition depending on their relative locations within the topology of the environment MODELING OF THE RANGE MEASUREMENT...

Interval mapping of human QTL using sib pair data

... statistic in multiple QTL mapping and the generalized linear model for interval mapping 16 Chapter 2: Interval Mapping of QTL in Human Chapter Interval Mapping of QTL in Human 2.1 Haseman-Elston ... 2: Interval Mapping of QTL in Human 2.2 Estimation of the proportion of alleles IBD shared at a QTL by a sib pair using the information in ﬂanking markers An important step in the interval mapping ... genotype probability of sib are diﬀerent from those of sib Therefore the probability of such a sib pair is θAB (1 − θAB )2 θBC (1 − θBC )2 16 Chapter 2: Interval Mapping of QTL in Human 23 Since there...

Báo cáo khoa học: Maturation of Pichia pastoris-derived recombinant pro-Der p 1 induced by deglycosylation and by the natural cysteine protease Der p 1 from house dust mite doc

... 2, rpro -Der p (X-33); lane 3, Endo H-treated rpro -Der p (X-33); lane 4, rpro -Der p (SMD 116 8h); lane 5, rpro -Der p Endo H-treated (SMD 116 8h); lane 6, rpro -Der p (GS 115 ); lane 7, rpro -Der p Endo ... nDer p (C) Lane 1, rpro -Der p (X-33); lane 2, rpro -Der p 1( SMD 116 8h); lane 3, Endo H-treated rpro -Der p 1; lane 4, nDer p 1; lane 5, prestained, broad-range precision ladder (Bio-Rad) other band ... SDS-PAGE/autoradiography Cleavage of 12 5I-labelled recombinant pro -Der p facilitated by puri®ed nDer p Lane 1, h rpro -Der p 1; lane 2, +0.37 lg nDer p 1; lane 3, +0.74 lg nDer p 1; lane 4, +1. 48 lg nDer p 1; lane 5,...

Xem thêm

Từ khóa: multiaxial fatigue assessment of welded structures by local approach ii assessment of emotional responses using visual analog scale vas fundamentals of data structures using c pdf in utero assessment of cardiovascular function in the embryonic mouse heart using high resolution ultrasound biomicroscopy damage assessment to duty of care damage tolerance assessment of bonded composite doubler repairs for commercial aircraft applications fao iaea coordinated research project quot assessment of the effectiveness of vaccination strategies against newcastle disease and gumboro disease using immunoassay based technologies for increasing farmyard poultry production in africa quot critical plane energy based approach for assessment of biaxial fatigue damage where the stress time axes are at different frequencies a thousand cuts an assessment of small boat grounding damage to shallow corals of the florida keys basics of building application assessment of air source schedule of weights of building materials phát trian assessment of water quality building queries using enterprise manager the representation of constituent structures Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ