Immunohistochemical expression of HBp17 FGFBP 1, FGF 1, FGF 2, CD34, p53, pRB, and ki67 in ameloblastomas

... Ph.D THESIS Immunohistochemical expression of HBp17/ FGFBP- 1, FGF -1, FGF- 2, CD34, p53, pRB, and Ki67 in Ameloblastomas by NGUYEN THANH TUNG Department of Molecular Oral Medicine and Maxillofacial ... HBp17/ FGFBP- 1, FGF -1, FGF- 2, CD34, p53, pRB and Ki67 in ameloblastomas 12 Double Ki67- CD34 antigens staining 14 Correlation betwee...

Ngày tải lên: 20/05/2016, 15:30

... heterogeneity of RPE cells [31,48] Effects of hypoxia on the expression of HO-1 in human RPE cell lines In contrast to interferon-c, hypoxia induced the expression levels of HO-1 mRNA in D407 cells and ... effects of interferon-c and hypoxia on HO-1 expression in human RPE cells, both of which have been shown to repress HO-1 expression in...

Ngày tải lên: 23/03/2014, 13:20

... evaluation of heme dynamics in cultured cells Role of heme metabolism in cellular heme content Regulatory role of free heme in expression of HO-1 To evaluate the contribution of heme synthesis and ... HO-1 protein was also induced by the treatment with HO-2 siRNA in HepG2 cells These results indicate that the down-regulation of HO-2 expression is...

Ngày tải lên: 19/02/2014, 05:20

... detected during the interaction of T harzianum and B cinerea and T harzianum with itself Table Biochemical characteristics of a-1,3-glucanases in Trichoderma sp Origin T asperellum CECT20539 T harzianum ... (a-1,3- and a-1,6-glucan), nigeran (a-1,3- and a-1,4-glucan), soluble starch (a-1,4- and a-1,6-glucan), pustulan (b-1,6-glucan), laminarin (b-1,3-glucan), carboxymethilcelullos...

Ngày tải lên: 19/02/2014, 16:20

... Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb ... acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc g [5] [5] [5] [5] [33] [33] [33] [34] [34] Page of (page number not for...

Ngày tải lên: 18/06/2014, 18:20

... Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb ... acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc g [5] [5] [5] [5] [33] [33] [33] [34] [34] Page of (page number not for...

Ngày tải lên: 20/06/2014, 01:20

... widely used in the literature [18 - 21] Whereas the mechanisms of the type PTH/PTHrP receptor (PTH1R) in osteoblasts were addressed in several studies [11 ,22-25], the expression of the PTH1R and its ... counted in the same section and measured in relation to the total number of chondrocytes Zonal attribution of PTH1R positive chondrocytes was d...

Ngày tải lên: 20/06/2014, 04:20

... ,doirep latnemirepxe eritne eht tuohguorht mutibil da retaw pat gniknird dna )aeroK ,gnaymaS( teid lamron a nevig erew slaminA aeroK ni ytisrevinU lanoitaN nowgnaK ta ytilicaf lamina devorppa na ni ... edixO cirtiN sisenegonicrac detaidem-noitammalfni fo ledom a : htiw detcefni sretsmah ni egamad AND evitartin inirreviv sihcrohtsipO dna evitadixo detaidem-ON fo msinahceM S ihsinawaK ,P...

Ngày tải lên: 07/08/2014, 18:21

... evidence of a link in MMP-1 and Bcl-3 expression, and indicate that both molecules are similarly affected by CDDO Expression of MMP-1, MMP-13, and Bcl-3 is inhibited in human chondrocytes pretreated ... that inhibit MMP gene expression, CDDO does not cause programmed cell death CDDO dose–response study in human primary chondrocytes To examine the effects o...

Ngày tải lên: 09/08/2014, 01:23

... crystal structures of CTX and NFX allowed us to make detailed comparison of 12 xylanases, five from thermophilic organisms This gives a more reliable comparison of the enzyme structures in relation to ... volumes indicating better packing In the comparison of PDB structures, Karshikoff and Ladenstein [51] have observed that proteins from thermophilic...

Ngày tải lên: 20/02/2014, 23:20

... FACS analysis of the internalization of the full-length Tat protein construct and the Tat CPP Differences in the mechanisms of internalization between the Tat peptide and the Tat fused protein ... at the surface of the Tat- containing recombinant proteins and call other reasons to explain the differences in the mechanism of interna...

Ngày tải lên: 21/02/2014, 03:20

... which was slightly active on the wild-type RT RNase H function, showed a sixfold increase in the inhibition potency of the RNase H function, although it retained its inhibition potency on the ... AQ derivatives and other RT inhibitors (A) YonetaniTheorell plot of the combination of K-49 and RDS 1643 on the HIV-1 RT polymeraseindependent RNase H a...

Ngày tải lên: 22/03/2014, 16:20

... phosphorylase There is evidence that PP1-GM and PP1-GL may be regulated acutely by insulin Assay of PP1 following insulin infusion of skeletal muscle and immunopelleting of PP1-GM showed a 1. 5–2-fold increase ... TGA gacgaggcgcctgcggccgacggcggaaaacaccaaaggcacccgggggcggggcgacccgatgtggcggggaggagtag 920 I H F I * 279 9 21 gagagaccaggattggcgggagcggtccaagggagtc 957 Fig (...

Ngày tải lên: 30/03/2014, 16:20

... length of the shorter side is 2 (2N ϩ 1) /4 meters, with both lengths rounded off to the nearest millimeter Of a sheet of paper, the dimensions 8.5 inches by 11 inches ( 21 6 millimeters by 27 9 millimeters) ... properties of air as a volume of 12 .4 cubic feet per pound at 14 .7 pounds per square inch (approximately 0.7756 cubic meter per kilogram at 10 1.36 kilopascals) and...

Ngày tải lên: 21/07/2014, 15:20

Ngày tải lên: 21/07/2014, 17:20