... Server Explorer For example, Figure 9 .1 shows the details of the ProductID column of the Products table As you can see, ProductID is an int Figure 9 .1: Obtaining the type of a column using Visual Studio ... unitPrice = 21. 35 unitsInStock = discontinued = True Using the GetSql* Methods to Read Column Values In addition to using the Get* methods to read colu...
Ngày tải lên: 24/12/2013, 01:17
... to use some of the methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... shows the SQL server types, the corresponding Sql* types, and the GetSql* methods used to read a column as the Sql* type Table 9.7: SQL SERVER TYPES, COMPATIB...
Ngày tải lên: 24/12/2013, 01:17
Tài liệu THE OLD MERCHANT MARINE, A CHRONICLE OF AMERICAN SHIPS AND SAILORS pptx
... Tryal and carry, in hand-to-hand conflict, the barricades of water-casks and bales of matting which the slaves had built across the deck There was no hanging back, and even a mite of a midshipman ... and Peru, and incidentally recaptured a Spanish ship which was in the hands of the slaves who formed her cargo This was all in the day's work and happened at...
Ngày tải lên: 17/02/2014, 01:20
Tài liệu An Example of Communal Currency pdf
... -+ ***** End of the Project Gutenberg EBook of An Example of Communal Currency, by J Theodore Harris *** END OF THIS PROJECT GUTENBERG EBOOK AN EXAMPLE OF COMMUNAL CURRENCY *** ***** This ... remain out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island...
Ngày tải lên: 17/02/2014, 19:20
Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc
... Congress Cataloging -in- Publication Data Arena, Mark V Why has the cost of Navy ships risen? : a macroscopic examination of the trends in U.S Naval ship costs over the past several decades / Mark V Arena, ... standards for research quality and objectivity Why Has the Cost of Navy Ships Risen? A Macroscopic Examination of th...
Ngày tải lên: 17/02/2014, 22:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx
... et al ˛ An example of peptide splicing Table Association constants (Ka) of SFTI-1 analogues based on the double-sequence of SFTI-1 Ch and T in parenthesis indicate that the inhibitory activity ... An example of peptide splicing A Łegowska et al ˛ A B Fig Chemical structures of (A) SFTI-1 and (B) synthesized analogues [KK]BiSFTI-1 (5), [FF]BiSFTI-1 (6)...
Ngày tải lên: 29/03/2014, 09:20
Images of Power in Hollywood Films: The Example of Star Wars ppt
... military power such as in the paintings of warships or the representation of cannon fire by kettle drums in musical compositions Images of international power are also likely to include depictions of ... 2000) 6 Hollywood films use American symbols like the Stars and Stripes, the Statue of Liberty, the Capitol The Statue of Lincoln in the Lincoln Memor...
Ngày tải lên: 30/03/2014, 14:20
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt
... al.: Heinrich event 1: an exemple of dynamical ice-sheet reaction to oceanic changes Evidence for strongly reduced NADW formation during Heinrich events (Sarnthein et al., 1994) has led to the ... ice-sheet reaction to oceanic changes Heinrich event Other Heinrich events Fennoscandian calving precursors / Otherwise-triggered* stadial state MelƟng of...
Ngày tải lên: 30/03/2014, 16:20
Báo cáo khoa học: The thermodynamic analysis of protein stabilization by sucrose and glycerol against pressure-induced unfolding The typical example of the 33-kDa protein from spinach photosystem II docx
... Kinetics of the pressure-induced unfolding and refolding of the 33-kDa protein in the presence of 30% glycerol Other conditions as in Fig Table Relaxation time of unfolding and refolding of the protein ... Stabilization of 33-kDa protein of spinach PS II against pressure unfolding (Eur J Biochem 270) 1657 Fig The effect of sucrose (m)...
Ngày tải lên: 31/03/2014, 01:20
– THE GRE QUANTITATIVE SECTION – Example of solving an equation: 3x + 5 = 20 –5 = –5 3x = pot
... by 5 , changing the direction of both inequality symbols: 5 ᎏᎏ 5 ■ 5 y 20 Ͻ ᎏᎏ Ͻ ᎏᎏ = Ͼ y Ͼ –4 5 5 The solution consists of all real numbers less than and greater than –4 1 75 – THE GRE QUANTITATIVE ... + 5) (x – 3) = Using the zero-product rule, it can be determined that either x + = or that x – = x +5 0 x–3ϭ0 x+ 5 5 ϭ 0 5...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... values analysis, item and subscales correlations and internal reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international ... adequate to generate reliable cross-cultural measures In conclusion, the Brazilian version of the AAQ instrument is a reliable, valid and consistent tool to as...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt
... Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains Figure Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains The ... Z: A DnaB intein in Rhodothermus marinus: indication of recent intein homing across remotely related organisms Proc Natl Acad Sci U S A 1997, 94:7851-7856 Tajima K, Nagamine T,...
Ngày tải lên: 18/06/2014, 22:20