66 expansion method for stationary states of quantum billiards david l kaufman american association of physics teachers

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx

INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx

... v INTERNATIONAL STANDARD ISO 6579:2002(E) Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp WARNING — In order to safeguard the health of ... Members of ISO and IEC maintain registers of currently valid International Standards ISO 6887-1, Microbiology of food and animal feedin...

Ngày tải lên: 07/03/2014, 16:20

34 690 0
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

... like to have an efficient algorithm for finding the best possible encoding of any given meet semilattice The encoding can be represented as a collection of sets of integers (representing bit indices ... optimal encoding is the collection of sets whose overall union is smallest subject to the constraint that the collection forms an encoding at all This combinatorial optimizatio...

Ngày tải lên: 17/03/2014, 00:20

10 410 0
Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot

Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot

... output of ChineseEnglish MT systems References E.H Hovy 1999 Toward finely differentiated evaluation metrics for machine translation In Proceedings of the Eagles Workshop on Standards and Evaluation, ... Human Evaluation Figure shows a linear regression of the monolingual group scores as a function of the BLEU score over two reference translations for the systems The high co...

Ngày tải lên: 23/03/2014, 20:20

8 337 0
Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)

Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)

... a water -cement ratio of 0.485 for all portland cements and 0.460 for all air-entraining portland cements The amount of mixing water for other than portland and air-entraining portland cements ... temperature before use 10 Procedure 10.1 Composition of Mortars: 10.1.1 The proportions of materials for the standard mortar shall be one part of cement to 2.75 parts of gr...

Ngày tải lên: 26/03/2014, 21:55

10 852 0
Đề tài " Uniform expansion bounds for Cayley graphs of SL2(Fp) " pptx

Đề tài " Uniform expansion bounds for Cayley graphs of SL2(Fp) " pptx

... Annals of Mathematics, 167 (2008), 625–642 Uniform expansion bounds for Cayley graphs of SL2(Fp) By Jean Bourgain and Alex Gamburd* Abstract We prove that Cayley graphs of SL2 (Fp ) are ... UNIFORM EXPANSION BOUNDS FOR CAYLEY GRAPHS OF SL2 (Fp ) 627 Our second result shows that random Cayley graphs of SL2 (Fp ) are expanders (Given a group G, a rand...

Ngày tải lên: 29/03/2014, 07:20

19 189 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

... calculation of distributional similarity The method is straightforward: Instead of using the point estimation of v(wi ), we first estimate the distribution of the context profile, p(v(wi )), by Bayesian estimation ... Conclusion ′ This will give: We proposed a Bayesian method for robust distributional word similarities Our method uses a distribution of context pr...

Ngày tải lên: 30/03/2014, 21:20

10 472 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...

Ngày tải lên: 05/05/2014, 15:26

8 634 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...

Ngày tải lên: 06/05/2014, 08:55

12 705 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

... patterns of the ZnO sample synthesized at 120 ◦C for 17 h hydrothermal treatment Figure a b d e c f Fig SEM images of the time-dependent evolution in the formation of 3D flower-like ZnO synthesized ... of the formation process of the 3D flower-like ZnO Figure Fig (a) Bar graph illustration of the photocatalytic degradation of KGL using ZnO samples s...

Ngày tải lên: 06/05/2014, 13:26

26 551 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approve...

Ngày tải lên: 20/06/2014, 04:20

4 403 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients ... A method for the early evaluation of the Ponseti (Iowa) technique for the treatment of idiopathic clubfoot J Pediatr Orthop 2003, 12(...

Ngày tải lên: 20/06/2014, 04:20

7 532 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients ... A method for the early evaluation of the Ponseti (Iowa) technique for the treatment of idiopathic clubfoot J Pediatr Orthop 2003, 12(...

Ngày tải lên: 20/06/2014, 07:20

7 803 0
Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx

Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx

... Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin (Rmutr), Bangkok 10100, Thailand 3Centre of Excellence in Mathematics, Che, Si Ayuthaya Road, Bangkok 10400, Thailand ... finding a common element of the set of solutions of generalized mixed equilibrium problems, the set of fixed points of a nonexpansive mapping and the set of sol...

Ngày tải lên: 21/06/2014, 01:20

20 351 0
Báo cáo hóa học: " Research Article The Shrinking Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Mappings" ppt

Báo cáo hóa học: " Research Article The Shrinking Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Mappings" ppt

... , and Kumam and Jaiboon 28 , we introduce a new shrinking projection method for finding a common element of the set of fixed points of strictly pseudocontractive mappings, the set of common solutions ... approximation method for finding a common element of the set of fixed point of strictly pseudocontractive mappings Journal of Inequalities...

Ngày tải lên: 21/06/2014, 05:20

25 496 0
w