... to total concentrations of multiple indoor air pollutants It is used as a complementary indicator to decrease indoor pollution level in total and achieve healthy indoor air environment. 109) The ... determination and the comparison of their value Indoor Environ., 11, 1–9 (in Japanese) Fukutomi, Y., Yasuda, H., Nakazawa, T., Taniguchi, M and Akiyama, K (20...
Ngày tải lên: 17/02/2014, 22:20
... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... was observed (not shown) The arrow indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome ... of an enzyme preparation containing only minor amounts of the 16-kDa c-type cytochrome The Table Features of the subunits of the Hme complex from A fulg...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx
... known They could be synthesized in the cytosol by glycosyltransferases which add glucosyl or galactosyl residues to the free trehalose that arises from trehalose phosphate by the action of the specific ... and isolated from the cytoplasm of M smegmatis, will also be found as part of the cell wall components of this organism All trehalose-containing structures rep...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo "Evolution of holocene depositional environments in the coastal area from the Tien river to the Hau river mouths " pot
... low-lying plain in front of river mouth or tidal channel inside islands The late Holocene lithofacies distributed from to -20 m water depth in the area of delta front and prodelta Seaward, with increasing ... available The pH value of clays varies from 6,9 to 7,5, Eh from -20mv to +150mv and Kt from 0,7 to 1,4 These environment indicators proved a brackis...
Ngày tải lên: 05/03/2014, 16:20
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... 10 of the experiment This inactivation was not due to a temperature rise during pressurization The b-glucosidase from P furiosus does not become inactivated after weeks of storage at temperatures ... compared to that of unpressurized samples The influence of pressure treatment on enzyme inactivation The inactivation of b-glucosidase was measured after pres...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the ... expressed at a high level (data not shown) DISCUSSION Computer analysis of b-expansins reveals significant similarity to cathepsins, which are members of the C1 fami...
Ngày tải lên: 08/03/2014, 22:20
A guide to larvae and juveniles of some common fsh species from the Mekong River Basin
... ventrally on tail Large triangular melanopore laterally over hypural bones, dorsal and anal fin Page 31 A guide to larvae and juveniles of some common fish species from the Mekong River Basin day ... laterally Dorsally and laterally on head and body Ventrally on tail Dorsal-fin spine, anterior, distal half of dorsal fin Page 37 A guide to larvae...
Ngày tải lên: 14/03/2014, 08:46
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... either: (a) dsRNA; or (b) small interference (si )RNA The longer dsRNA may generate a large population of siRNA (with 21–23 nucleotides), and the use of longer dsRNA may be advantageous over siRNA ... corresponding to the mature peptide of MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-...
Ngày tải lên: 16/03/2014, 05:20