Development of new routes of severe plastic deformation through cyclic expansion–extrusion process

... 40 Photographs of (a) MA-SCA and (b) MA-TEY microbioreactors after 14 days of fermentation 128 Figure 41 Photographs of (a) GG-SCA and (b) GG-TEY microbioreactors after 14 days of fermentation ... Bio- ethanol B1 Application of bio- ethanol in transportation B2 Production of bio- ethanol Saccharomyces cerevisiae D Bioreactors D1 E F Advantages of using bioreactor...

Ngày tải lên: 30/09/2015, 06:24

... center The New Town includes three components: Bac Linh Dam (North of Linh Dam) , Linh Dam peninsula in the middle and Linh Dam expansion (South of Linh Dam) The success of the project has set the ... south-west of Linh Dam lake with higher density of construction 665 Linh Dam new town - Solution for the High-density devel...

Ngày tải lên: 29/08/2013, 08:15

... nặng nhọc với mức thu nhập thấp, kéo theo điều kiện sống mức tối thiểu, tạm bợ khu nhà trọ rẻ tiền với điều kiện sinh hoạt an ninh không đảm bảo Đời sống tinh thần lao động hạn chế Họ thấy cô ... có xu hướng linh hoạt phụ thuộc nhiều vào mặt hàng họ bán “độ đắt hàng” Trung bình họ làm việc 13,09 giờ/ngày lúc bắt đầu công việc từ 2h30 - 3h00 sáng mặt hàng họ bán rau, hoa, quả… - 7h s...

Ngày tải lên: 29/08/2013, 08:15

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

... development by the project manager through ecollaboration Project management process All projects have a beginning and an ending, and project management has corresponding initiating and closing ... facilitate the progression to reduce time and cost in developing new products in SMEs To understand the importance of coordinating these sections with the...

Ngày tải lên: 07/03/2014, 00:20

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 18/06/2014, 18:20

... descriptions of oily skin were: "shiny" (n = 23), "greasy" (n = 17), "oily" (n = 7) and "annoying" (n = 6) Participants described the appearance of their oily skin as being "shiny" and oily "like an ... terms such as "greasy", "clammy", "slimy" and "slippery" and also referred to their skin feeling "dirty" or "grimy" and talked about a "heavy" feeling Internet Focus Group Results...

Ngày tải lên: 18/06/2014, 19:20

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 20/06/2014, 01:20

... Team Leader: Dr Tran Xuan Hanh Australian Organisation: Australian Personnel: Australian Animal Health Laboratory (AAHL), PMB 24, Geelong, VIC 3220, Australia Mr Chris Morrissy Date commenced: 01/03/2008 ... culture propagated vaccine CSF vaccine to allow the production of a cheap and high quality vaccine To enhance the diagnostic capability of Vietnamese laboratories to facilitat...

Ngày tải lên: 21/06/2014, 05:20

... strain rate of Ta films with d of 10 and 20 nm The ml is determined from the slope of the lines The inset shows the Young’s modulus versus strain rate of Ta films with different values of d that of ... http://www.nanoscalereslett.com/content/6/1/186 the total time of deposition, the thickness of the films was kept at about μm Different temperature...

Ngày tải lên: 21/06/2014, 05:20

... important method in order to avoid micro fracture in metal forming The void growth due to plastic deformation causes the softening and increases the accumulated damage of material There is a good ... equivalent stress of material matrix The void initiation and effects of necking are not involved in the fracture criterion of Mc.Clintock For this reason, the pred...

Ngày tải lên: 22/07/2014, 06:20

... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison of ... is affected less by a branch of equal thickness, the growth potential has to be integrated in the model to describe the effect of branchiness on tree qualit...

Ngày tải lên: 08/08/2014, 14:22

... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the ... RTQ -PCR assay These findings suggest that the ultra sensitive RTQ -PCR assay is equally reliable as the Figure Comparison of the HBV-DNA values estimated using COBAS TaqM...

Ngày tải lên: 12/08/2014, 04:20

... screening of a small-insert partial genomic library of C canephora (robusta coffee) Interestingly, all these markers exhibit broad cross-species transferability We also demonstrate their utility ... Mozambicoffea (E Africa) Mozambicoffea (E Africa) Mozambicoffea (C Africa) Melanocoffea (W Africa) Paracoffea (India) Paracoffea (India) Development of new SSR markers I...

Ngày tải lên: 12/08/2014, 05:20