Luận văn a comparative study of discourse structures and linguistic features between information communication technology news in english and vietnamese

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

... LINGUISTIC FEATURES OF THE INTERNATIONAL CONVENTION ON HUMAN RIGHTS IN COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4 .2 20 Purposes and typical ... Preamble of the Convention and their realization 4.3.1 21 23 The Body 23 4.3 .2. 1 The Body of the Convention and its realization 23 4.3 .2. 2 Remarks 2...

Ngày tải lên: 07/11/2012, 14:17

6 634 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  3

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3

... differences between international Declarations and Conventions 32 in terms of discourse structures and major linguistic features International Declarations and International Conventions are legal documents, ... Convention 4 .3 A STUDY OF THE DISCOURSE STRUCTURE AND MAJOR LINGUISTIC FEATURES OF INTERNATIONAL CONVENTIONS ON HUMAN RIGH...

Ngày tải lên: 07/11/2012, 14:17

41 839 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  4

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

... spirit of article 29; (b) Encourage international co-operation in the production, exchange and dissemination of such information and material from a diversity of cultural, national and international ... education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessib...

Ngày tải lên: 07/11/2012, 14:17

28 612 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Indirect-HMM-based Hypothesis Alignment for Combining Outputs from Machine Translation Systems In Proceeding of EMNLP Hawaii, US, Oct F Huang and K Papinent 2007 Hierarchical System Combination for Machine Translation ... word alignments are ready, we start from the intersection of the two word alignments, and then continuously add new links between backbone and h...

Ngày tải lên: 17/03/2014, 01:20

8 547 1
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in sus...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
báo cáo khoa học: " Medical tourism and policy implications for health systems: a conceptual framework from a comparative study of Thailand, Singapore and Malaysia" pot

báo cáo khoa học: " Medical tourism and policy implications for health systems: a conceptual framework from a comparative study of Thailand, Singapore and Malaysia" pot

... Singapore, Thailand and Malaysia as the three main hubs for medical tourism in Southeast Asia for comparative analysis Broadly, there are four types of comparative health policy analyses The first ... decades This paper presents a conceptual framework (Figure 1) that identifies the policy implications of medical tourism for health systems, from a...

Ngày tải lên: 11/08/2014, 14:21

12 464 0
A comparative study of the biological and physical properties of viscosity enhanced root repair material (VERRM) AND MTA

A comparative study of the biological and physical properties of viscosity enhanced root repair material (VERRM) AND MTA

... A COMPARATIVE STUDY OF THE BIOLOGICAL AND PHYSICAL PROPERTIES OF VISCOSITY ENHANCED ROOT REPAIR MATERIAL (VERRM) AND MTA PALLAVI UPPANGALA (BDS RGUHS, India) A THESIS SUBMITTED FOR THE DEGREE ... Maxillofacial Surgery, Faculty of Dentistry Thesis Title: A comparative study of the biological and physical properties of Viscosity...

Ngày tải lên: 15/09/2015, 22:51

95 778 0
A comparative study of singapores chinatown and bangkoks chinatown

A comparative study of singapores chinatown and bangkoks chinatown

... Street) and Yaowarat; the shopkeepers conducting businesses in Pagoda and Trengganu Street and Yaowarat Road and Charoen Krung Road and members of the temple and foundation hospitals As this is a comparative ... 13 that a comparative analysis can offer us more insight into broader social changes that have taken place in the Singapore case and allow for a more nuanced...

Ngày tải lên: 05/10/2015, 18:58

190 584 0
The issue of lesbianism in contemporary indian films  a comparative study of transnational, bollywood and regional film

The issue of lesbianism in contemporary indian films a comparative study of transnational, bollywood and regional film

... Contemporary Indian Films: A Comparative Study of Transnational, Bollywood and Regional Films Introduction Contemporary Indian cinema has undergone substantial changes over the last couple of decades ... in this thesis, The Journey, or Sancharram in Malayalam, is an example of a regional Indian film made in the Indian state of Kerala Mala...

Ngày tải lên: 16/10/2015, 12:00

130 833 0
Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

... constructed a string-to -dependency translation platform for comparing non-isomorphic target dependency structures Specially, we proposed an algorithm for generating word-based dependency trees from ... evaluation In Proceedings of NTCIR-9, pages 579– 584 David Magerman 1995 Statistical decision-tree models for parsing In In Proceedings of of the 33rd Annual Meeting of...

Ngày tải lên: 30/03/2014, 17:20

5 411 0
Internationnal payment A case study of freight forwarding and logistics companies in Vietnam  Luận văn thạc sĩ

Internationnal payment A case study of freight forwarding and logistics companies in Vietnam Luận văn thạc sĩ

... remarkable advantages, forwarding and logistics companies can participate and perform very well the role of a key chain in international payments Settling via international freight forwarding and ... 4.2 Forwarding and logistics in international payment, in reality 34 As an international business, forwarding and logistics companies should operate thei...

Ngày tải lên: 26/05/2015, 08:33

100 684 0
The chinese discourse marker suoyi  a comparative study of its usage between native speakers and singapore mandarin learners

The chinese discourse marker suoyi a comparative study of its usage between native speakers and singapore mandarin learners

... ——母语者和新加坡汉语学习者使用情况对比研究 THE CHINESE DISCOURSE MARKER "SUOYI" : A COMPARATIVE STUDY OF ITS USAGE BETWEEN NATIVE SPEAKERS AND SINGAPORE MANDARIN LEARNERS 王荣耀 WANG RONGYAO 新加坡国立大学中文系 硕士学位论文 A THESIS SUBMITTED FOR THE ... use the data forming the basis of my analysis as part of her project “Spoken Vocabulary of...

Ngày tải lên: 01/10/2015, 17:27

123 1,1K 0
w