Active Sway Suppression Techniques of a Gantry Crane System

... study was to evaluate the safety and efficacy of masitinib in the treatment of DMARDrefractory active RA Materials and methods Patients Patients from 18 to 75 years of age who had been diagnosed ... administered orally in two daily intakes To evaluate the dose response of masitinib in DMARD-refractory active RA, dose ranging was performed by randomly assigning pa...

Ngày tải lên: 09/08/2014, 14:22

... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of ac...

Ngày tải lên: 12/09/2012, 15:05

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database. In Procee...

Ngày tải lên: 16/03/2014, 16:20

... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to acc...

Ngày tải lên: 17/03/2014, 19:21

... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 201...

Ngày tải lên: 23/03/2014, 14:20

... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate ... tive value of percent as the amount tax receipts that parkland adds to the assessed value of all dwellings within 500 feet of parks (The preponderance of studies has reveale...

Ngày tải lên: 02/04/2014, 08:20

... other than u1 and u2, then the interior of 〚u1, u2〛 is either a subset of the basin of attraction of u1 or a subset of the basin of attraction of u2 Kalabušić et al Advances in Difference Equations ... subset of the basin of attraction of E All orbits that start below this curve are attracted to E1 All orbits that start above this curve are attracted to E (A1 −...

Ngày tải lên: 21/06/2014, 00:20

... this article as: Zhang et al.: Local existence and uniqueness of solutions of a degenerate parabolic system Advances in Difference Equations 2011 2011:12 Submit your manuscript to a journal and ... gradients of solutions to degenerate parabolic systems Discr Contin Dyn Syst 26(2), 597–608 (2010) 14 Ladyzenskaja, OA, Solonnikov, VA, Ural’ceva, NN: Linear and q...

Ngày tải lên: 21/06/2014, 03:20

... involves an active human role Natural enemies of insect pests, also known as biological control agents, include predators, parasites, and pathogens Virtually all pests have some natural enemies, and ... Journal of Inequalities and Applications 17 12 J Sugie, “Two-parameter bifurcation in a predator-prey system of Ivlev type,” Journal of Mathematical Analysis and Appli...

Ngày tải lên: 21/06/2014, 07:20

... 1983 24 O Ladyzenskaja, V Solonnikov, and N Uraltseva, “Linear and quasilinear equations of parabolic type,” in Translations of Mathematical Monographs, vol 23, American Mathematical Society, ... “Global existence and blow-up for a nonlinear reaction-diffusion system,” Journal of Mathematical Analysis and Applications, vol 212, no 2, pp 481–492, 1997 Journal of Inequalities and Appl...

Ngày tải lên: 21/06/2014, 07:20

... that is, Ax ∗ ≤ A · x ∗ (4.1) for all x ∈ Rm and any (m × m) matrix A For real (m × m) matrix A, we define, as usual, A = max1≤ j ≤m m |ai j | and A ∞ = i= max1≤i≤m m |ai j | j= We will give a ... and D Komissarova References [1] L Berezansky and E Braverman, On exponential dichotomy, Bohl-Perron type theorems and stability of difference equations, Journal of Mathematical Analysi...

Ngày tải lên: 22/06/2014, 22:20

... exploits multipath channel parameters CONCLUSIONS In this paper, a new method for estimating the multipath channel parameters of a single user in the uplink of a DSCDMA system has been proposed The estimation ... way similar to S(τ) based on the already estimated path delays The value of the search step size δ a ects the estimation accuracy of...

Ngày tải lên: 22/06/2014, 22:20

... oaks and several acacias, which show marked differences in shoot growth and ramification Materials and Methods Acorns of oaks (Quercus petraea Liebl., Q rubra du Roi) and seeds of acacias (Acacia ... Statistical studies of these ture are data allow the determination of elongation laws and branching patterns They may then be integrated into a deterministic three-dimensi...

Ngày tải lên: 09/08/2014, 02:21

... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...

Ngày tải lên: 10/08/2014, 05:21