Design in the DNA how a design ethos can drive business growth

Design in the DNA   how a design ethos can drive business growth

Design in the DNA how a design ethos can drive business growth

... telephones Design in the DNA: How a design ethos can drive business growth CASE STUDY Aravind proves there’s richness in frugality India’s Aravind Eye Care System has shown that taking a frugal approach ... optical cables ■■ India’s Tata Nano, the world’s cheapest car, at US$2,000 Design in the DNA: How a design ethos can drive business grow...
Ngày tải lên : 06/12/2015, 23:07
  • 24
  • 204
  • 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCC...
Ngày tải lên : 07/03/2014, 12:20
  • 16
  • 397
  • 0
Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf

Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf

... Gregorio-Jorge et al.: Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region ... strains A and B of Euphorbia mosaic virus respectively, are actually incompatible in replication, hence implying that these...
Ngày tải lên : 12/08/2014, 01:22
  • 15
  • 694
  • 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of ac...
Ngày tải lên : 12/09/2012, 15:05
  • 23
  • 1.3K
  • 1
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

... size of the Internet, let alone to make an estimation of the amount of information that is available on or through it; • The dynamic nature of the information on Internet: information that cannot ... Theory Intelligent Software Agents in Practise Intelligent Software Agents in Practise 3.1 Applications of Intelligent Agents The current app...
Ngày tải lên : 08/10/2012, 15:22
  • 100
  • 811
  • 3
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety ... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse...
Ngày tải lên : 25/10/2012, 11:18
  • 6
  • 550
  • 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

... MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income ... sound influence on behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Fa...
Ngày tải lên : 06/09/2013, 05:48
  • 23
  • 552
  • 0
an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

... supplying the information has become less important: demand for information is becoming the most important aspect of the information chain What's more, information is playing an increasingly ... deduce these rules by observing a user's behaviour and trying to find patterns in it; Information Access and Management: Information access and management is an area of g...
Ngày tải lên : 26/10/2013, 17:15
  • 100
  • 412
  • 0
Từ khóa: