The silent pandemic tackling hepatitis c with policy innovation

The silent pandemic tackling hepatitis c with policy innovation

The silent pandemic tackling hepatitis c with policy innovation

... alone a local level According to the World Hepatitis Alliance, a patient group, within the The silent pandemic Tackling hepatitis C with policy innovation European Union (EU) only the Netherlands ... Conclusion for a detailed list of actions) © The Economist Intelligence Unit Limited 2012 The silent pandemic Tackling hepatitis C with policy innovatio...

Ngày tải lên: 04/12/2015, 00:24

24 181 0
The silent pandemic  tackling hepatitis c with policy innovation

The silent pandemic tackling hepatitis c with policy innovation

... and psychologically too difficult for many in this category to complete the course of treatment, which can last 48 weeks Looking ahead, the French healthcare system faces strategic choices if ... much research in the field, existing public health surveillance does not produce certain basic information – including changing figures for prevalence, incidence, the percentage of those affe...

Ngày tải lên: 04/12/2015, 00:24

5 153 0
Tackling hepatitis c moving towards an integrated policy approach

Tackling hepatitis c moving towards an integrated policy approach

... integrated policy approach About this report Tackling hepatitis C: Moving towards an integrated policy approach is an Economist Intelligence Unit report, commissioned and funded by Janssen, which investigates ... strategic-action-planagainst-hepatitises-inromania-2013.htm Tackling hepatitis C: Moving towards an integrated policy approach Euro Hepatit...

Ngày tải lên: 04/12/2015, 00:20

17 136 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

... histological, biochemical, genetic and demographic markers that may further predict the outcome of HCV infections Figure Natural History of HCV Infection Extrahepatic Manifestations Chronic HCV infection ... patients not clear the virus by months, and chronic hepatitis develops The rate of chronic HCV infection is affected by many factors, including the age at time of infectio...

Ngày tải lên: 02/11/2012, 09:56

6 531 0
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

... behaviours associated with the acquisition of HCV infection in injecting drug users HCV transmission risk behaviours include injecting drugs, the sharing of injecting equipment, not cleaning and reusing ... regular staff of community drug services that took part in the trial All therapists received an intensive training programme in the administration of ma...

Ngày tải lên: 11/08/2014, 18:20

12 454 0
Báo cáo khoa học: " Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats" pptx

Báo cáo khoa học: " Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats" pptx

... to induce strong and specific humoral and cellular immune responses makes them potential candidates for designing a prophylactic and therapeutic vaccine against HCV Taken together the results of ... vaccination against hepatitis C virus (HCV): effect of expressing different forms of HCV E2 protein and use of CpGoptimized vectors in mice Vaccine 2002, 20:326...

Ngày tải lên: 12/08/2014, 04:21

10 265 0
Báo cáo hóa học: " Hepatitis C virus NS5A protein binds the SH3 domain of the Fyn tyrosine kinase with high affinity: mutagenic analysis of residues within the SH3 domain that ?" doc

Báo cáo hóa học: " Hepatitis C virus NS5A protein binds the SH3 domain of the Fyn tyrosine kinase with high affinity: mutagenic analysis of residues within the SH3 domain that ?" doc

... affinity to that exhibited by the Nef :SH3 domain interaction We conclude that NS5A binds to SH3 domains with high affinity, and such interactions could occur in the context of an HCV infected cell Results ... http://www.virologyj.com/content/5/1/24 Figure Surface plasmon resonance analysis of the NS5A( Δ250) :Fyn SH3 domain interaction Surface plasmon reson...

Ngày tải lên: 20/06/2014, 01:20

9 447 0
Báo cáo khoa học: "Hepatic splenosis mimicking HCC in a patient with hepatitis C liver cirrhosis and mildly raised alpha feto protein; the important role of explorative laparoscopy" potx

Báo cáo khoa học: "Hepatic splenosis mimicking HCC in a patient with hepatitis C liver cirrhosis and mildly raised alpha feto protein; the important role of explorative laparoscopy" potx

... significant impact of clinical plans and patients management It is already recognized that laparoscopy provides a port of minimally invasive entry for the visualisation of suspect masses, and allows ... Figure CT scan1 CT scan (A) Axial IV contrast enhanced CT Arterial phase image showing a × 2.7 cm hypervascular, subcapsular nodule in segment VII of the liver (B) Port...

Ngày tải lên: 09/08/2014, 04:20

4 452 0
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx

Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx

... Hashimoto E, Hayashi N: Predictors of the efficacy of interferon therapy in chronic hepatitis C virus infection Tokyo-Chiba Hepatitis Research Group 1997, 113:558-66 Kaufman RJ: The Double-stranded ... region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani pati...

Ngày tải lên: 11/08/2014, 21:21

5 254 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher ... LOD of the duplex real-time RT-PCR assay was 38.99 IU/ml and the specificity was 100% Furthermore, the cost of the duplex real-time RT-PCR assay was considerably lower than t...

Ngày tải lên: 12/08/2014, 04:20

9 322 0
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

... alleles with HCV infection were observed in either Caucasians or nonCaucasians in the present study The associations of HLA- class II alleles with HCV infection The protective associations of DRB1*0101 ... the outcome of HCV infection Therefore, recognition of racial differences in HLA associations is likely important in studying the immune response...

Ngày tải lên: 12/08/2014, 04:21

8 499 0
Báo cáo y học: "Overview of the diagnostic value of biochemical markers of liver fibrosis (FibroTest, HCV FibroSure) and necrosis (ActiTest) in patients with chronic hepatitis C" doc

Báo cáo y học: "Overview of the diagnostic value of biochemical markers of liver fibrosis (FibroTest, HCV FibroSure) and necrosis (ActiTest) in patients with chronic hepatitis C" doc

... biopsy for the first line assessment of liver injury in patients with chronic hepatitis C In clinical practice, liver biopsy should be recommended only as a second line test, i.e., in case of high ... carried out biochemical analyses RP, DT, VR, and YB participated in the coordination of the study, and drafted the manuscript AM participated in the d...

Ngày tải lên: 13/08/2014, 13:20

12 214 0
Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

... was associated with SVR (P=0.05) Age, ethnicity, 38 gender, drug abuse, and histology were not significantly associated with SVR To allow for clinical applicability, logistic regression with clinical ... and liver histology and did not reach statistical significance Table 1: Baseline demographic, clinical characteristics and laboratory data of the study population Characte...

Ngày tải lên: 26/10/2012, 09:39

7 519 0
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

... immunoblotting as described in Fig 6C The black and white arrowheads indicate Cardif and the cleaved Cardif, respectively (B) Cardif is cleaved by NS3-4A in the cured Oc cells The Oc cells were cotransfected ... sites of pCX4pur ⁄ myc, which can express myc-tagged protein, according to the previously described method [39] To construct pCX4pur ⁄ myc-TRIF, the EcoRINotI fra...

Ngày tải lên: 18/02/2014, 16:20

16 524 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...

Ngày tải lên: 20/02/2014, 01:20

15 598 0
Từ khóa:
w