Societal purpose a journey in its early stages
... between a clear purpose and financial performance And corporations are increasingly urged to embrace a societal purpose in response to the idea that social media outlets have the power to increase a ... of the Indian-headquartered conglomerate Tata Sons Corporations with stated societal purpose include some familiar names, such as: Examples of societal purpose Organizati...
Ngày tải lên: 04/12/2015, 00:18
... (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAA TGGCGGCGGATGCTCTGAG3' and 5'GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCAGCAACTTCTTCTTGAT CCTTG3') The expression clone was inserted into the donor vector pDONR201, and subsequently transformed ... through PCR amplification with the primer LBa-1 (located on the TDNA insert: 5'TGGTTCACGTAGTGGGCCATCG3') and primers flanking the predicted inserts (5'AAAAACAAAAGCAGACA...
Ngày tải lên: 12/08/2014, 05:20
... 25:1322-1325 Wanless IR, Sapp H, Guindy M, Olshansky D, Takayama A: The pathogenesis of focal nodular hyperplasia/ an hypothesis based on histological review of 20 lesions including occurring in early biliary ... Glutamine synthase immunostaining Glutamine synthase immunostaining A: Normal expression of GS around the central vein (non -nodular tissue) B: Exte...
Ngày tải lên: 13/08/2014, 13:20
Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century
... turned into pastures for sheep-raising and wood-making industries They had to join the force of cheap labor and working in such factories England became a typical example of initial accumulation of ... in God Master servant relationship in “ Robinson Crusoe can also be seen as a relation of capitalism as they devided labour among them with equal shares The fact is tha...
Ngày tải lên: 26/11/2012, 12:02
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
... that HSL gains accessible hydrophobic surface area upon PKA phosphorylation This gain in hydrophobic surface area presumably accounts for the increase in in vitro activity of HSL following PKA ... solvent-exposed hydrophobic surface area of HSL following PKA phosphorylation was examined using both bis-ANS and SYPRO Orange Because of the interaction of bot...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... Media Supplement as a substitute of FBS, and a defined amount of glutamine, as detailed below Measurement of L -glutamine uptake by Caco-2 cells Glutamine uptake in Caco-2 cells was initiated by adding ... FEBS Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteo...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
... in a language other than English 11 Supporting Children Learning English as a Second Language in the Early Years (birth to six years) Learning English as a second or an additional language Babies ... English as a Second Language in the Early Years (birth to six years) Language delay Research has shown that mos...
Ngày tải lên: 24/02/2014, 18:20
Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt
... & Yamazaki A (2002) Binding of cGMP to GAF domains in amphibian rod photoreceptor cGMP phosphodiesterase (PDE) Identification of GAF domains in PDE alphabeta subunits and distinct domains in the ... A Yamazaki et al Fig Binding of [3H ]cGMP to Pabc (A) Concentration of [3H ]cGMP [3H ]cGMP binding to Pabc (1.92 lg) was measured with the indicated concent...
Ngày tải lên: 06/03/2014, 00:21
A Journey Through France in War Time pptx
... Undoubtedly in the coming years France will make extraordinary strides in industrial progress She is planning—indeed has already under way, many projects of manufacture, transportation, housing, labor-conservation ... we arrived at Bourboule and had dinner at the Palace Hotel We met here Col Cosby, military attache of the American Embassy in Paris This is a watering place and conta...
Ngày tải lên: 06/03/2014, 03:21
A JOURNEY TO AMERICA IN 1834 pot
... an appropriate prayer, alluding to our peculiar situation and praying for a safe voyage; and also those in the other parts of the vessel, also the Captain and family It was intended to have a ... out to promenade the deck Saw a ship yesterday The gale again increased[8] towards evening and I feared a poor night A very good pancake half way across the Atlantic SUNDAY, MAY 11T...
Ngày tải lên: 06/03/2014, 12:21
A prophetical medicine appears in its new scientific perspective ppt
... cupping to light anew Page 10 "CUPPING" A prophetical medicine appears in its new scientific perspective Dr A M Al-Shalati, a specialist in neural diseases from UK and a professor in Damascus ... Al-Dayrani "CUPPING": A prophetical (Divine) medicine appears in its new scientific perspective Authored By Humane Scholar Mohammad Amin Sheikho Checked...
Ngày tải lên: 08/03/2014, 14:20
corporate social responsibility in viet nam a study of its importance for vietnamese investors
... Date Abstract CORPORATE SOCIAL RESPONSIBILITY IN VIET NAM: A STUDY OF ITS IMPORTANCE FOR VIETNAMESE INVESTORS BY NGUYEN CONG VIET June 2010 Supervisor: Dr Le Van Lien Corporate Social Responsibility ... 12 contaminated milk in Vietnam, people are scared of using that product Recently, a Taiwanese-owned company in Quang Minh industrial zone near Ha No...
Ngày tải lên: 13/03/2014, 14:20