OCT 3 4 and SOX 2 are key factors for SDIA neurogenesis of mouse embryonic stem cells

OCT 3 4 and SOX 2 are key factors for SDIA neurogenesis of mouse embryonic stem cells

OCT 3 4 and SOX 2 are key factors for SDIA neurogenesis of mouse embryonic stem cells

... 35 04 - 36 02 139 - 22 6 20 7 - 31 3 45 0 - 559 11 13 - 130 8 1 637 - 1 8 32 1559 - 1665 39 9 - 5 92 3. 60 3. 62 3. 99 4 . 34 4. 78 3. 68 3. 26 3. 4 3. 4 32 .8 29 .25 30 .7 30 .8 35 .8 27 .2 29.1 28 .3 30.8 Bold designates ... Sox- 2 297 – 37 8 5 73 – 677 1056 - 11 53 71 - 23 0 11 82 - 1 34 5 4. 55 2. 98 3. 68 3. 49 4 .36 19 .4 33 .9 28 .2...

Ngày tải lên: 27/11/2015, 11:25

88 344 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

... for the HS4 core enhancer (HS4), a region 5¢- to HS3 (5¢HS3), the core of HS3 (HS3), a region flanking HS2 and HS3 (3 ⁄ flank), the core of HS2 (HS2), a region downstream of HS2 (3 HS2), and the ... progenitor cells Discussion B Fig Transcription of LCR hypersensitive site in undifferentiated murine embryonic stem cells and in human CD 133 + bone m...

Ngày tải lên: 07/03/2014, 12:20

10 422 0
báo cáo hóa học: " Co-morbidity and visual acuity are risk factors for health-related quality of life decline: five-month follow-up EQ-5D data of visually impaired older patients" ppt

báo cáo hóa học: " Co-morbidity and visual acuity are risk factors for health-related quality of life decline: five-month follow-up EQ-5D data of visually impaired older patients" ppt

... general analyses on the EQ-5D To put the EQ-5D scores from the visually impaired older population into perspective, we compared baseline data of the visually impaired older patients (mean age ... more of the visually impaired older patients reported having some or severe problems on all dimensions of the EQ-5D compared with both reference groups However, the pr...

Ngày tải lên: 18/06/2014, 19:20

9 420 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

... family, the miR-200 family have been reported in human [16,17] and mouse embryonic stem cells [18-20] The unique patterns of miRNA expression in embryonic stem cells suggest they are involved in maintaining ... instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[ 73] Another me...

Ngày tải lên: 18/06/2014, 15:20

17 593 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem...

Ngày tải lên: 11/08/2014, 12:21

13 338 0
Identification of oct4 and sox2 targets in mouse embryonic stem cells

Identification of oct4 and sox2 targets in mouse embryonic stem cells

... Optimisation of the Oct4 and Sox2 ChIP assays 57 3.2.2 Oct4 and Sox2 bind to the distal enhancer of Oct4 in mESCs 58 3.2.3 Oct4 and Sox2 bind to the SRR2 of Sox2 in mESCs 59 3.2.4 Oct4 and Sox2 bind to ... Specificity of Oct4 and Sox2 antibodies used in ChIP 3.2 Oct4 and Sox2 binding to Oct4 CR4 region in mESCs 3.3 Oct4 and Sox2 bi...

Ngày tải lên: 11/09/2015, 16:03

270 263 0
The derivation, propagation, storage and gene expression of human embryonic stem cells on human feeders

The derivation, propagation, storage and gene expression of human embryonic stem cells on human feeders

... in the body There are four classes of pluripotent stem cells in humans, other primates and mice These are embryonic stem cells, embryonic germ cells, embryonic carcinoma cells and recently the ... stem cells versus embryonic stem cells The general differences between the characteristics of adult and embryonic stem cells are summarised in Table...

Ngày tải lên: 16/09/2015, 15:55

207 366 0
Directed differentiation of human embryonic stem cells into haematopoietic and definitive endodermal lineages

Directed differentiation of human embryonic stem cells into haematopoietic and definitive endodermal lineages

... endoderm differentiation of hESCs Table 5.1 Available information on knock-out phenotypes in the mouse vii LIST OF FIGURES Figure 1.1 Embryonic origin of human embryonic stem cells and their ... CD86 and CD83 that enhance the activation of naive T cells 14 Figure 1.5 Haematopoietic development Pluripotent stem cells give rise to multipotent haematopoietic st...

Ngày tải lên: 04/10/2015, 16:03

296 2K 0
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28

Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28

... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCAC...

Ngày tải lên: 16/10/2015, 11:58

109 371 0
báo cáo hóa học:" Editorial Image and Video Processing for Cultural Heritage Vincent Charvillat,1 Anna Tonazzini (EURASIP Member),2 Luc Van Gool,3, 4 and Nikos Nikolaidis (EURASIP Member)5 1 IRIT," potx

báo cáo hóa học:" Editorial Image and Video Processing for Cultural Heritage Vincent Charvillat,1 Anna Tonazzini (EURASIP Member),2 Luc Van Gool,3, 4 and Nikos Nikolaidis (EURASIP Member)5 1 IRIT," potx

... assistance of the editorial support team of the EURASIP Journal on Image and Video Processing throughout the preparation of this issue Vincent Charvillat Anna Tonazzini Luc Van Gool Nikos Nikolaidis ... the contributors, for making this issue a hopefully important source of information within the existing body of knowledge in the field of image and video proces...

Ngày tải lên: 21/06/2014, 18:20

3 331 0
GA TD 1,2,3,4,5 + TNXH1,2,3

GA TD 1,2,3,4,5 + TNXH1,2,3

... héi” +Tranh chiỊu vỊ - Cho h/s quan s¸t tranh ®a sè c©u hái : +Tranh cđa b¹n Hoµng Phong vÏ ban ngµy hay ban ®ªm? +Tranh vÏ c¶nh ë ®©u? + V× b¹n Hoang phong l¹i ®Ỉt tªn tranh lµ chiỊu vỊ? + Mµu ... gµ nh¸p - Gv q/s¸t gióp ®ì h/s tËp vÏ vµ xÐ c¸c bé phËn cđa gµ + Th©n gµ + §Çu gµ - h/s nªu + §u«i gµ + Ch©n gµ, vÏ m¾t, má gµ + Y/c h/s d¸n h×nh gµ vµo vë D Cđng cè, dỈ...

Ngày tải lên: 08/11/2013, 10:11

110 310 0
Bài giảng Bai khao sat mon TOAN 1,2,3,4,5 Thang 2- 2011

Bài giảng Bai khao sat mon TOAN 1,2,3,4,5 Thang 2- 2011

... 6:3x2= Bài : Cô giáo chia 35 cho bạn tổ em, bạn Hỏi tổ em có bạn ? (2 điểm) Bài làm Bài 5: Tìm x (2 điểm) X x = 35 x X = 21 Bài khảo sát chất lợng tháng năm 2011 Môn toán lớp Bài : So ... Bài khảo sát chất lợng tháng năm 2011 Môn toán lớp Họ tên lớp Bài 1: (4 điểm) đặt tính tính 1205 x 3224 : 2319 x 1865 : Bài 2: (2 điểm) Tìm x 87 : x = x = 84 : Bài : Khoanh ... 7x4x3x7...

Ngày tải lên: 01/12/2013, 00:11

5 350 0
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

... J D Dikeakos et al is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a stabilizing P-domain involved ... protein A sepharose, separated by SDS ⁄ PAGE, and detected by fluorography (C) Autoradiograms similar to those shown in (B) were exposed to storage phosphor screen and quantifi...

Ngày tải lên: 18/02/2014, 16:20

9 600 0
Sáng kiến kinh nghiệm mầm non môn thể dục lớp 3-4 tuổi – bài 2 đi theo đường hẹp, bò bằng bàn tay, cẳng chân pptx

Sáng kiến kinh nghiệm mầm non môn thể dục lớp 3-4 tuổi – bài 2 đi theo đường hẹp, bò bằng bàn tay, cẳng chân pptx

... cho nửa lớp bò, nửa lớp đứng xem (2 lần) Khi bò, không cúi đầu, cẳng chân sát sàn Cho trẻ đứng thành hàng ngang đối diện (đứng bên đường kẻ sẵn) Lần lượt cho trẻ vào vị trí chuẩn bị theo đường ... trẻ đi, chạy theo cô, kết hợp với kiểng chân Sau đứng thành vòng tròn - Trọng động : Phát triển chung Động tác bật : Bật trước * lần + Vận động : Cho lớp bò vào vòng tròn,...

Ngày tải lên: 08/08/2014, 04:20

2 1,1K 2
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

... embryogenesis and morphogenesis of various tissues and organs, where they regulate growth, differentiation, chemotaxis and apoptosis of a variety of cell types, including mesenchymal, epithelial, ... compare the effects of BMP-4 and BMP-2 expression on chondrogenesis of primary MSCs and to investigate whether levels and extent of hypertrophy in vitro is influ...

Ngày tải lên: 09/08/2014, 14:22

15 830 0
w