Cellular energy supply and aging in dairy cows characterization of different physiological states and impact of diet induced over condition

... biogenesis in blood and in tissues during different stages of lactation in PP and MP dairy cows, and 3) To give an overview about TL and TL- shortening in dairy cows during different stages of lactation ... status in over- conditioned dairy cows 1.1.2 The importance of adipose tissue in dairy cows 1.1.3 Adipose tissue angiogenesis 1.2 Cellular...

Ngày tải lên: 26/11/2015, 10:17

... rate during the warm season for the first lactation and during the cold season for the second lactation Cow parity and calving season were eliminated from the final model since they did not influence ... service and/ or conception were not related to the occurrence of retained placenta [6,35,47] The effect of retained placenta was much greater on the...

Ngày tải lên: 07/08/2014, 18:21

... dedulcni LP fo noitinifed ehT ]71[ sisongaid ycnangerp evitisop a rof noiretirc eht saw yhpargonosartlu yb sutef ro oyrbme ,elcisev eht fo noitingoceR noitaplap launam dna yhpargonosartlu htob gnimrofrep ... lamron rof kcehc ot yhpargonosartlu dna noitaplap latcer yb denimaxe saw woc LP hcae fo tcart evitcudorper ehT ]53,7[ yduts siht ni ssol latef dna ssol cinoyrbme etal htob dedulcni LP ,su...

Ngày tải lên: 07/08/2014, 23:22

... from clinical mastitis in dairy cows Int J Antimicrob Agents 2002, 19:219-226 FINRES-Vet 2005-2006: Finnish veterinary antimicrobial resistance monitoring and consumption of antimicrobial agents ... isolates showing intermediate susceptibility and resistance were observed with ampicillin, neomycin, streptomycin and tetracycline E coli was 98.4% susceptible to enroflo...

Ngày tải lên: 12/08/2014, 18:22

... al.: Metabolic and endocrine profiles and reproductive parameters in dairy cows under grazing conditions: effect of polymorphisms in somatotropic axis genes Acta Veterinaria Scandinavica 2011 53:35 ... Page of 10 Table F-tests of fixed effects included in the model for productive /reproductive parameters and metabolic/ endocrine variables and...

Ngày tải lên: 12/08/2014, 18:22

... pathogens from cases of acute clinical mastitis in dairy cows Vet Microbiol 2009, 136(1-2):142-149 IDF: Suggested interpretation of mastitis terminology International Dairy Federation Bulletine ... knowledge of trends in the panorama of microorganisms causing subclinical mastitis Conclusions Staphylococcus aureus and CNS were the most frequently isolated pat...

Ngày tải lên: 12/08/2014, 18:22

... between mastitis and MY during the first 180 days of first-lactation Norwegian Red cows For comparison, the data were also analyzed using standard multivariate linear and Gaussian-threshold models, as ... specifications The data were analyzed using a standard multivariate linear sire model (LM), a recursive multivariate linear sire model (R-LM), a standard Gaussian-thres...

Ngày tải lên: 14/08/2014, 13:22

... analysis of bcp1, bcp3 and bcp4 under oxidative stress The involvement of bcp1, bcp3 and bcp4 in oxidative stress was investigated by assessing mRNA levels following treatment of S solfataricus ... contrast, the Bcp3 sequence only shows one cysteine at position 42 in the N-terminal region Expression and purification of Bcp1, Bcp3 and Bcp4 bcp1, bcp3...

Ngày tải lên: 07/03/2014, 05:20

... 2001 276 T Thilsing-Hansen & R.J Jørgensen tence of an antagonistic effect between calcium and zinc in dairy cows as evidenced by the drop in serum calcium following zinc oxide administration together ... dietary calcium had no effect on absorption of zinc in the lactating cow The aim of the present experiment was to examine further the antagonism between calcium and...

Ngày tải lên: 12/08/2014, 15:20

... quantitative insulin sensitivity check index is better correlated to hyperinsulinemic glucose clamp than other fasting-based index of insulin sensitivity in different insulin- resistant states J Clin Endocrinol ... CR: Insulin resistance, insulin insensitivity, and insulin unresponsiveness: a necessary distinction Metabolism 1978, 27(12 Suppl 2):1893-1902 Bugianesi E, McCul...

Ngày tải lên: 12/08/2014, 18:22

... Cytokines initiate the inflammatory response, which induces the acute phase response (APR) by activating the production of acute phase proteins (APP) such as serum amyloid-A (SAA), haptoglobin (Hp) ... quarter in two consecutive E coli challenges Total daily milk yield (kg) and milk yield (kg) of the experimentally infected quarter following two consecutive intramamm...

Ngày tải lên: 12/08/2014, 18:22

... Rasmussen et al.: Changes in thermal nociceptive responses in dairy cows following experimentally induced Escherichia coli mastitis Acta Veterinaria Scandinavica 2011 53:32 Submit your next manuscript ... [24] using dairy cows, nor Veissier et al [11] examining nociceptive threshold in healthy Holstein bull calves found effects of repeated testing with an interv...

Ngày tải lên: 12/08/2014, 18:22

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... pivotal role of the UPR is to maintain ER homeostasis Therefore, the presence of mutated proteins that are unable to fold into their native conformation in the ER induces the UPR in an effort to restabilize ... expressed in tobacco protoplasts in the absence of a B chain [152] The degradation of ricin A chain is brefeldin A-insensitive and is inhibited by...

Ngày tải lên: 16/03/2014, 11:20

... TGF-β1 in the urine of male rats after CYP were also significantly higher than the levels of active and total TGF-β1 in the urine of female rats, both at baseline and after CYP (ANOVA, Tukey post ... control rats collected at the same time point of the day The levels of NO2-/NO3- in the urine of CYP-treated female rats remained higher as compared to both CY...

Ngày tải lên: 11/08/2014, 08:22