Cellular energy supply and aging in dairy cows characterization of different physiological states and impact of diet induced over condition
Cellular energy supply and aging in dairy cows characterization of different physiological states and impact of diet induced over condition
... biogenesis in blood and in tissues during different stages of lactation in PP and MP dairy cows, and 3) To give an overview about TL and TL- shortening in dairy cows during different stages of lactation ... status in over- conditioned dairy cows 1.1.2 The importance of adipose tissue in dairy cows 1.1.3 Adipose tissue angiogenesis 1.2 Cellular energy- supply in metabolism of dairy cows 1.2.1 The role of ... in tissue samples of these cows as well as in AT of overconditioned, non-lactating dairy cows The effects of over- condition on oxidative stress related changes in mtDNA content in non-lactating...
- 108
- 334
- 0
Báo cáo khoa học: " Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows" potx
... rate during the warm season for the first lactation and during the cold season for the second lactation Cow parity and calving season were eliminated from the final model since they did not influence ... service and/ or conception were not related to the occurrence of retained placenta [6,35,47] The effect of retained placenta was much greater on the interval from calving to conception than the effect ... diagnosed by the presence of the following clinical signs: weakness, cold skin, and favorable response Data collection and processing for determination of the risk factors for retained placenta Data...
- 7
- 465
- 1
Báo cáo khoa học: "Pregnancy loss in dairy cows: the contributing factors, the effects on reproductive performance and the economic impact" doc
... dedulcni LP fo noitinifed ehT ]71[ sisongaid ycnangerp evitisop a rof noiretirc eht saw yhpargonosartlu yb sutef ro oyrbme ,elcisev eht fo noitingoceR noitaplap launam dna yhpargonosartlu htob gnimrofrep ... lamron rof kcehc ot yhpargonosartlu dna noitaplap latcer yb denimaxe saw woc LP hcae fo tcart evitcudorper ehT ]53,7[ yduts siht ni ssol latef dna ssol cinoyrbme etal htob dedulcni LP ,suhT sisongaid ... desongaid eW LP fo noitceted dna sisongaid ycnangerP )noitaluvo fo noitazinorhcnys gniwollof IA( IA demit a deviecer locotorp IA demit desab-RDIC eht dah ohw esoht saerehw ,)surtse fo noitazinorhcnys...
- 6
- 299
- 1
Báo cáo khoa học: "Udder pathogens and their resistance to antimicrobial agents in dairy cows in Estonia" ppsx
... from clinical mastitis in dairy cows Int J Antimicrob Agents 2002, 19:219-226 FINRES-Vet 2005-2006: Finnish veterinary antimicrobial resistance monitoring and consumption of antimicrobial agents ... isolates showing intermediate susceptibility and resistance were observed with ampicillin, neomycin, streptomycin and tetracycline E coli was 98.4% susceptible to enrofloxacin and 100% to cefaperazone ... 59.5%, respectively In addition, CNS showed resistance to penicillin and ampicillin (38.5% and 34.4%), but resistance to erythromycin and lincomycin was also common (14.9% and 17.6%) Six isolates...
- 7
- 360
- 0
Báo cáo khoa học: "Metabolic and endocrine profiles and reproductive parameters in dairy cows under grazing conditions: effect of polymorphisms in somatotropic axis genes" doc
... al.: Metabolic and endocrine profiles and reproductive parameters in dairy cows under grazing conditions: effect of polymorphisms in somatotropic axis genes Acta Veterinaria Scandinavica 2011 53:35 ... Page of 10 Table F-tests of fixed effects included in the model for productive /reproductive parameters and metabolic/ endocrine variables and BCS of Holstein cows under grazing conditions in two ... the endocrine and metabolic profiles of the transition dairy cow under grazing conditions Acknowledgements and funding The present study received financial support from the National Institute of...
- 10
- 288
- 0
Báo cáo khoa học: "Etiology and antimicrobial susceptibility of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden" pps
... pathogens from cases of acute clinical mastitis in dairy cows Vet Microbiol 2009, 136(1-2):142-149 IDF: Suggested interpretation of mastitis terminology International Dairy Federation Bulletine ... knowledge of trends in the panorama of microorganisms causing subclinical mastitis Conclusions Staphylococcus aureus and CNS were the most frequently isolated pathogens from cows with subclinical mastitis ... susceptibility of udder pathogens in a random selection of dairy herds in Sweden Moreover, a specific aim of the study was also to investigate differences between newly infected cows and chronically infected...
- 8
- 381
- 0
Báo cáo sinh học: " Exploration of lagged relationships between mastitis and milk yield in dairy cows using a Bayesian structural equation Gaussian-threshold model" pdf
... between mastitis and MY during the first 180 days of first-lactation Norwegian Red cows For comparison, the data were also analyzed using standard multivariate linear and Gaussian-threshold models, as ... specifications The data were analyzed using a standard multivariate linear sire model (LM), a recursive multivariate linear sire model (R-LM), a standard Gaussian-threshold (GT) sire model, and a recursive ... structural equation models are described for inferring SIR relationships between binary (e.g., diseases) and continuous (e.g., production) characters A Bayesian analysis via Markov chain Monte Carlo...
- 25
- 378
- 0
Báo cáo khoa học: Peroxiredoxins as cellular guardians in Sulfolobus solfataricus – characterization of Bcp1, Bcp3 and Bcp4 pot
... analysis of bcp1, bcp3 and bcp4 under oxidative stress The involvement of bcp1, bcp3 and bcp4 in oxidative stress was investigated by assessing mRNA levels following treatment of S solfataricus ... contrast, the Bcp3 sequence only shows one cysteine at position 42 in the N-terminal region Expression and purification of Bcp1, Bcp3 and Bcp4 bcp1, bcp3 and bcp4 were amplified by PCR from S solfataricus ... form of pUC19 are indicated on the left by arrows Temperature dependence and thermostability of Bcp1, Bcp3 and Bcp4 To characterize the thermophilicity of recombinant Bcp1, Bcp3 and Bcp4, we investigated...
- 11
- 439
- 0
Báo cáo khoa học: "Serum Calcium Response Following Oral Zinc Oxide Administrations in Dairy Cows" docx
... 2001 276 T Thilsing-Hansen & R.J Jørgensen tence of an antagonistic effect between calcium and zinc in dairy cows as evidenced by the drop in serum calcium following zinc oxide administration together ... dietary calcium had no effect on absorption of zinc in the lactating cow The aim of the present experiment was to examine further the antagonism between calcium and zinc in dairy cows by following ... dose rates of zinc oxide to lactating dairy cows N Z Vet J 1984, 32, 48-50 Smith BL, Embling PP: The in uence of chemical form of zinc on the effect of toxic intraruminal doses of zinc to sheep...
- 8
- 160
- 0
Báo cáo khoa học: "A model to estimate insulin sensitivity in dairy cows" doc
... quantitative insulin sensitivity check index is better correlated to hyperinsulinemic glucose clamp than other fasting-based index of insulin sensitivity in different insulin- resistant states J Clin Endocrinol ... CR: Insulin resistance, insulin insensitivity, and insulin unresponsiveness: a necessary distinction Metabolism 1978, 27(12 Suppl 2):1893-1902 Bugianesi E, McCullough AJ, Marchesini G: Insulin ... an index of insulin function in dairy cows The first aim of the present study was to monitor normal variations in RQUICKI during the period from calving to mid-lactation in high producing dairy...
- 3
- 316
- 0
Báo cáo khoa học: " Acute phase response in two consecutive experimentally induced E. coli intramammary infections in dairy cows" pptx
... Cytokines initiate the inflammatory response, which induces the acute phase response (APR) by activating the production of acute phase proteins (APP) such as serum amyloid-A (SAA), haptoglobin (Hp) ... quarter in two consecutive E coli challenges Total daily milk yield (kg) and milk yield (kg) of the experimentally infected quarter following two consecutive intramammary challenges with E coli ... previous intramammary infection by the same pathogen [22] In our study using two consecutive intramammary challenges with E coli, all cows became infected and developed local (swelling, soreness,...
- 10
- 269
- 0
Báo cáo khoa học: "Changes in thermal nociceptive responses in dairy cows following experimentally induced Escherichia coli mastitis" doc
... Rasmussen et al.: Changes in thermal nociceptive responses in dairy cows following experimentally induced Escherichia coli mastitis Acta Veterinaria Scandinavica 2011 53:32 Submit your next manuscript ... [24] using dairy cows, nor Veissier et al [11] examining nociceptive threshold in healthy Holstein bull calves found effects of repeated testing with an interval of 24 h In the present study, increased ... toward nociceptive stimulation in dairy cows in early lactation over a period of 10 days during and after experimentally induced E coli mastitis Methods Animals and housing Eight Danish Holstein-Friesian...
- 7
- 260
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1) ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b...
- 12
- 588
- 0
Báo cáo khoa học: Cellular response to unfolded proteins in the endoplasmic reticulum of plants pptx
... pivotal role of the UPR is to maintain ER homeostasis Therefore, the presence of mutated proteins that are unable to fold into their native conformation in the ER induces the UPR in an effort to restabilize ... expressed in tobacco protoplasts in the absence of a B chain [152] The degradation of ricin A chain is brefeldin A-insensitive and is inhibited by the proteasome inhibitor clasto-lactacystin b-lactone, ... management of unfolded proteins in the endoplasmic reticulum Cell 101, 451–454 Patil C & Water P (2001) Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response...
- 20
- 438
- 0
Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx
... TGF-β1 in the urine of male rats after CYP were also significantly higher than the levels of active and total TGF-β1 in the urine of female rats, both at baseline and after CYP (ANOVA, Tukey post ... control rats collected at the same time point of the day The levels of NO2-/NO3- in the urine of CYP-treated female rats remained higher as compared to both CYP-treated and control male rats (ANOVA, ... (panel A) was maintained across all groups The substantial levels of latent TGF-β1 in female rats at baseline and after CYP was accompanied by only minor levels of active TGF-β1 in bladder tissue...
- 13
- 244
- 0
Từ khóa: suspect and search for the early signs of aging in the upper third of the facepredisposing factors for non infectious claw disorders in dairy cows under varying zero grazing systemsproteomic technology in the molecular characterization of novel therapeutic targets future perspectivesthe pulmonary mesenchymal tissue layer is defective in an in vitro recombinant model of nitrofen induced lung hypoplasiaalterations in myocardial cellular energy and diastolic function a potential role for d ribosefuture perspectives of milk and dairy products from autochthonous dairy cows reared in northern italyrecent trends in fish supply and demandatlas of household energy consumption and expenditure in indiadiploma in logistics and supply chain management in malaysiaphd in logistics and supply chain management in malaysiamsc in logistics and supply chain management in malaysiamba in logistics and supply chain management in malaysiamaster in logistics and supply chain management in malaysiamasters in logistics and supply chain management in malaysiastate the law of supply and demand in economicsNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ