The effect of s1p lyase deficiency on the metabolism of the alzheimer’s related amyloid precursor protein

... Modulation of intracellular S1P concentration affect the metabolism of APP ………… 47 3.1.1 Accumulation of S1P in S1P- lyase deficient cells …………………………………… 47 3.1.2 Genetic deletion of S1P- lyase results ... Colocalization of highly concentrated GSLs can hamper the processing and the degradation of APP Only little information on the role of S1P in the me...

Ngày tải lên: 25/11/2015, 15:23

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and...

Ngày tải lên: 18/02/2014, 13:20

... c-secretase cleavage of APP substrates is inhibited by zinc and that zinc increases the apparent molecular mass of C1013FLAG as determined by size exclusion chromatography Residues 6–28 within Ab ... exposures allowed the detection of a protein with a calculated molecular mass of 11.1 kDa migrating between a- and c-3FLAG standard proteins that may correspo...

Ngày tải lên: 16/03/2014, 23:20

... study that investigated the levels of different MMPs in plasma of AD patients [30] The increased levels of several MMPs in the CSF of individuals with increased risk for AD, as observed in the current ... elevated in healthy elderly individuals with CSF biomarker levels implying an increased risk of future development of AD In addition, increas...

Ngày tải lên: 22/03/2014, 14:20

... envisaged as coordination of the metal ion by the nitrogens of the imidazole rings of the histidines and the amino group in the N-terminus Use of the signal intensity reduction of the 1H–13C HSQC crosspeaks ... J Danielsson et al Zinc-binding site of the amyloid b-peptide The aromatic region of the 1H–13C HSQC spectrum is particularly informative ab...

Ngày tải lên: 23/03/2014, 10:20

... Gasparini, L., Binetti, G., Trabucchi, M., Bianchetti, A & Racchi, M (1998) Speci c role for protein kinase C alpha in the constitutive and regulated secretion of amyloid precursor protein in human ... obtained with strategies involving the overexpression of the PKCe V1 region, which binds specifically to the receptor for activated C -kinase (RACK), bloc...

Ngày tải lên: 23/03/2014, 13:20

... protein APLP2 by the disintegrin and metalloproteinases ADAM10 and TACE (ADAM17), and a common upregulation of ADAM10 and its substrate by RA The main criteria for the involvement of ADAMs, the ... cells, the amount of the pro- and the mature form of this proteinase even decreased in SKNMC cells, revealing reduced stability compared with ADAM...

Ngày tải lên: 30/03/2014, 11:20

... that both ADAM10 and TACE are involved in the shedding of APP, neither ADAM is involved in the shedding of ACE Furthermore we show that APMA can distinguish between the shedding of ACE and APP ... would appear that ADAM10 and TACE are not critically involved in the shedding of ACE APMA has been reported to induce the shedding of a number of pro...

Ngày tải lên: 30/03/2014, 14:20

... [41] Therefore, alteration of the charge of the protein could be induced at the vicinity of the monolayer A difference in the orientation of the protein moiety during the insertion process into the ... of the secreted form of amyloid precursor protein by interfering with glycosylation in the protein secretory pathway Biochem J 348, 2307–2313 16 Refolo, L.M....

Ngày tải lên: 31/03/2014, 21:21

... 27 LIFE OUT OF FOCUS: ALZHEIMER’S DISEASE AND RELATED DISORDERS One of the tragic effects of Alzheimer’s is that children and grandchildren may become strangers to victims of the disease Humans ... right times 43 LIFE OUT OF FOCUS: ALZHEIMER’S DISEASE AND RELATED DISORDERS THE COST OF ALZHEIMER’S DISEASE As you can imagine, Alzheimer’s disease i...

Ngày tải lên: 05/03/2014, 23:20

... Psychoemotional aftermath With respect to the tsunami's psychoemotional aftermath, the full impact of the wave on the mental health of the survivors is still unknown [2] In February 2005 the World ... estimation about the force with which the victims were hit and swept away by the wave Antiinfective therapy Our intial choice of anti-infective therapy was a combinatio...

Ngày tải lên: 25/10/2012, 10:41

... exoerythrocytic [6] and erythrocytic [7] cycle However, there is almost no information on the effect of antibodies on the expression of Plasmodium immunogenic molecules There are evidences that antibodies can ... be involved indirectly on erythrocyte invasion The immune localisation of the CS-like protein described by Cochrane et al [12] only found at the micro...

Ngày tải lên: 02/11/2012, 10:14

... considering only one of the channels in the regression (either the change, which given the MASTER THESIS: THE EFFECT OF EDUCATION ON ECONOMIC GROWTH negative correlation, would lead to an important ... individuals go in the same direction than with the whole population, confirming thereby my previous results Conclusion The literature on the effect of educati...

Ngày tải lên: 24/08/2013, 18:40

... determine the effect of the number of the ventilation pipes on the composting rate, an attempt was made to correlate the composting rate with the number of the perforated pipes for air supply in the ... ventilation effect by the natural convection (Shimizu and Morita, 1962) However, there have been no studies of the effect of the verti...

Ngày tải lên: 05/09/2013, 08:40

... with incubation time In other word, the adsorption capacity of PAC increased with increase in the amount of organic carbon on PAC The adsorption capacity of PAC after 4th incubation was almost the ... of organic carbon on PAC after each incubation Figure Figure shows the adsorption isotherm of new PAC, PAC in the aeration tank, and PAC after...

Ngày tải lên: 05/09/2013, 08:40