Optimal fundamental characteristic of a quantum harmonic

Optimal fundamental characteristic of a quantum harmonic

Optimal fundamental characteristic of a quantum harmonic

... irreversibilities of heat resistance, internal friction and bypass heat leakage The working medium of the quantum refrigerator is consisting of many noninteracting harmonic oscillators The quantum refrigeration ... cooling load when there exists a bypass heat leakage The optimal performance of the quantum Carnot refrigerator at high temperature limit is derived and analyze...

Ngày tải lên: 20/11/2015, 14:04

16 124 0
homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

... we have read the dissertation prepared by Panagiota Savva Konstantinou entitled Homomorphisms of the Fundamental Group of a Surface into PSU(1, 1), and the Action of the Mapping Class Group and ... thank my friends of many years Avra Charalambous, Georgia Papageorgiou and Anna Sidera for their continual support and the great summers I spent with t...

Ngày tải lên: 13/11/2014, 09:14

88 324 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

... effects of a combination of key residues Further analysis of these and other mutant SODs is currently underway ACKNOWLEDGEMENTS We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses ... D., Hiraoka, B .Y. , Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and destruction of conserved Trp159 of Fesuperoxide dismutase from Porphyro...

Ngày tải lên: 21/02/2014, 01:21

12 741 0
On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt

On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt

... banks sector Basic considerations for the reorganisation of savings banks and Landesbanks Irrespective of the concrete legal organisational structure, a restructuring of the Landesbanks and savings ... number of examples have already demonstrated Chart 1: Split of Landesbanks 4.1 Sparkassenregionalinstitute (SRIs) The integration of savings banks...

Ngày tải lên: 15/03/2014, 10:20

26 499 0
Optimal Design of a Hybrid Electric Car with Solar Cells pptx

Optimal Design of a Hybrid Electric Car with Solar Cells pptx

... solar panels It exhibit a payback of 3.13 years The addition of and m2 of solar panels (cases 2-3) increases solar fraction up to 30% but also payback to 8.7 years, since the greater daily saving ... reliability of panels in case of lateral impacts) APV ,V ,MAX = (2l + w )(h − 0.9 ) − 0.1 w l FIG - SIMPLIFIED SCHEME OF SOLAR CAR (LATERAL AND REAR VIEW) The maximum pane...

Ngày tải lên: 30/03/2014, 10:20

12 600 0
Báo cáo hóa học: " Weak reverse Hölder inequality of weakly A-harmonic sensors and Hölder continuity of A-harmonic sensors" potx

Báo cáo hóa học: " Weak reverse Hölder inequality of weakly A-harmonic sensors and Hölder continuity of A-harmonic sensors" potx

... the weak reverse Hölder inequality for weakly A-harmonic sensors, and the second result is to establish the Hölder continuity of A-harmonic sensors 2.1 Weak reverse Hölder inequality of weakly A-harmonic ... Agarwal, Ding and Nolder in [2] In [5], there is a weak reverse Hölder inequality for very weak solutions of some classes of equatio...

Ngày tải lên: 20/06/2014, 22:20

10 231 0
Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

... Breit-Wigner peak centered at the bonding molecular state and an asymmetrical Fano line shape centered at the antibonding molecular state The degree of the asymmetry of the Fano-Like peak can be attributed ... Spin-polarized current and spin accumulation in a three-terminal two quantum dots ring Appl Phys Lett 2008, 92:172104-172106 41 Uchida K, Takahashi S, Harii K, Ieda J, Kos...

Ngày tải lên: 20/06/2014, 23:20

10 351 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
Báo cáo hóa học: " Improved conversion efficiency of Ag2S quantum dot-sensitized solar cells based on TiO2 nanotubes with a ZnO recombination barrier layer" pdf

Báo cáo hóa học: " Improved conversion efficiency of Ag2S quantum dot-sensitized solar cells based on TiO2 nanotubes with a ZnO recombination barrier layer" pdf

... this article as: Chen et al.: Improved conversion efficiency of Ag2S quantum dot-sensitized solar cells based on TiO2 nanotubes with a ZnO recombination barrier layer Nanoscale Research Letters ... efficiencies of as-prepared Ag2S quantum dot-sensitized solar cells, the Figure The photoconversion efficiencies of the Ag2S( 8) /ZnO/ TNT and Ag2...

Ngày tải lên: 21/06/2014, 01:20

9 398 0
Báo cáo hóa học: " Nanomechanical properties of a-synuclein amyloid fibrils: a comparative study by nanoindentation, harmonic force microscopy, and Peakforce QNM" potx

Báo cáo hóa học: " Nanomechanical properties of a-synuclein amyloid fibrils: a comparative study by nanoindentation, harmonic force microscopy, and Peakforce QNM" potx

... increased data throughput [18-20] Two commercially available approaches are PeakForce QNM and Harmonic force microscopy or HarmoniX (Veeco, Santa Barbara, CA, USA) PeakForce QNM is based on the force- volume ... nN) and C and D in ambient conditions (setpoint is 16 nN) The fibrils have in these images an average modulus of elasticity of GPa and mica between and GPa Imag...

Ngày tải lên: 21/06/2014, 04:20

10 459 0
Báo cáo hóa học: " Linear Rashba Model of a Hydrogenic Donor Impurity in GaAs/GaAlAs Quantum Wells" potx

Báo cáo hóa học: " Linear Rashba Model of a Hydrogenic Donor Impurity in GaAs/GaAlAs Quantum Wells" potx

... vertical dashed lines indicate the value of a0 and the borderline of the QW, respectively Fig The change in spin-orbit splitting energy C as the position of the impurity under the linear Rashba model ... state is more localizing than the excited states in QWs These changing trends are found in Fig In summary, we proposed a linear Rashba model along the z directi...

Ngày tải lên: 22/06/2014, 01:20

3 248 0
Báo cáo hóa học: " Strain Relief Analysis of InN Quantum Dots Grown on GaN ´ ´ Juan G. Lozano Æ Ana M. Sanchez Æ Rafael Garcıa Æ ´ Sandra Ruffenach Æ Olivier Briot Æ David Gonzalez" pot

Báo cáo hóa học: " Strain Relief Analysis of InN Quantum Dots Grown on GaN ´ ´ Juan G. Lozano Æ Ana M. Sanchez Æ Rafael Garcıa Æ ´ Sandra Ruffenach Æ Olivier Briot Æ David Gonzalez" pot

... is: f ¼ QD dInN dGaN QD dInN d¼ Fig PVTEM micrograph of an InN quantum dot showing three ´ sets of translational moire fringes QD dGaN À dInN dGaN À dInN ð2Þ where er is the residual strain, f ... O Briot, S Ruffenach, J Crystal Growth 269, 15 (2004) ´ ´ ´ J.G Lozano, D Gonzalez, A.M Sanchez, D Araujo, S Ruf´ fenach, O Briot, R Garcıa, Phys Stat Sol 3, 1687 (2006)...

Ngày tải lên: 22/06/2014, 18:20

5 240 0
Từ khóa:
w