... of elimination of routine chest radiographs in a pediatric intensive care unit Crit Care Med 1999, 27:1588-1593 Hall JB, White SR, Karrison T: Efficacy of daily routine chest radiographs in intubated, ... were routine films Nine of 35 (25.7%) patients had an average of 1.6 additional films over a period In this quality assurance survey, we observed...
Ngày tải lên: 25/10/2012, 10:45
Ngày tải lên: 18/02/2014, 11:20
Báo cáo sinh học: "Autologous Transplantation of Adipose-Derived Mesenchymal Stem Cells Markedly Reduced Acute Ischemia-Reperfusion Lung Injury in a Rodent Model" potx
... Figure Impact of Adipose-Derived Mesenchymal Stem Cells (ADMSC) Transplantation on the Severity of IR-Induced Lung Parenchymal Injury Number of alveolar sacs and crowded area (was defined in methodology ... proliferation after acute lung injury, in animals after acute lung IR Additionally, the number of alveolar sacs was significantly decreased, whereas the...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo y học: "Cartilage preservation by inhibition of Janus kinase 3 in two rodent models of rheumatoid arthritis" doc
... molecule inhibitor of the tyrosine kinase Janus kinase (JAK3), an enzyme that is associated with the common gamma chain (γc) of various cytokine receptors and is critical for signal transduction by interleukin ... efficacious in murine CIA when dosed The efficacy produced by CP-690550 in the rodent models of arthritis may result from its ability to affect signaling of...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: " Discovery of serum biomarkers of alcoholic fatty liver in a rodent model: C-reactive protein" doc
... surveillance marker of alcoholinduced fatty liver in a rodent model, which may help diagnose early alcohol-induced pathophysiological alterations in clinical practice Materials and methods Animal ... Page of 10 compared To ensure the correct establishment of the animal models, several indicators in the serum including aspartate aminotransferase (AST), alanine aminotransf...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Metronidazole-induced encephalopathy in a patient with infectious colitis: a case repo" doc
... white matter of the cerebral hemispheres [4,8] Lesions are always symmetric and bilateral, which is a typical pattern of metabolic encephalopathy In each of the cases we reviewed, including ours, ... Therefore, awareness of the potential neurological side effects of metronidazole and an accurate clinical impression of the attending physician is very important in metronida...
Ngày tải lên: 11/08/2014, 00:22
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: "Duration of salmeterol-induced bronchodilation in mechanically ventilated chronic obstructive pulmonary disease patients: a prospective clinical study" pot
... oxygen that achieved a hemoglobin saturation of greater than 89% Minute ventilation was adjusted in each individual by the attending physician in order to maintain normal arterial pH and remained ... significant at any time interval after salmeterol administration (Table 2) SaO2 remained constant throughout the study period, indicating that clinically significant changes in PaO2 as...
Ngày tải lên: 13/08/2014, 11:23
A proteomics study of chemically induced cirrhosis in rat liver revealed the mechanism of thioacelamide hepatotoxicity 3
... SR 63 3 ,3, 3,2 ,3, 3,2 ,3, 3,2 SR17 3, 3 ,3, 3 ,3, 3 ,3, 3 ,3, 2 SR18 3, 3 ,3, 3 ,3, 3 ,3, 3 ,3, 2 SR19 2 ,3, 2,2 ,3, 3 ,3, 2 ,3, 3 SR21 2,2,2 ,3, 2,2,1,2,2 ,3 SR22 4 ,3, 3 ,3, 4 ,3, 3 ,3, 2 ,3 84 Chapter 3 week control week experimental ... (Table 3- 2 and Figure 3- 2) and 10 weeks (Table 3- 3 and Figure 3- 3) of treatment, most of the ten fields examined in the treated...
Ngày tải lên: 16/09/2015, 17:13
A proteomics study of chemically induced cirrhosis in rat liver revealed the mechanism of thioacelamide hepatotoxicity 4
... found that in vivo TAA administration to male rat had been demonstrated to inhibit δ-aminolevulinic acid (ALA) synthetase (Matsuura et al., 1983) In the same paper, Matsuura and co-workers also ... vacuolar apparatus in macrophages during inflammation (Sakaida et al., 1990) Since oxidative stress and inflammation are both implicated to be associated with TAA hepatotoxicity, the r...
Ngày tải lên: 16/09/2015, 17:13
A proteomics study of chemically induced cirrhosis in rat liver revealed the mechanism of thioacelamide hepatotoxicity 2
... stirring with a magnetic stirrer 2. 2.3 Administration of TAA TAA was administered to the rats via intraperitoneal injection Each rat was weighed before being injected with 300 mg/kg of TAA using the ... food and water These rats were kept for a week for acclimatization prior to thioacetamide (TAA) administration 2. 2 .2 Preparation of 10% thioacetamide To prepare a 10% T...
Ngày tải lên: 16/09/2015, 17:14
A proteomics study of chemically induced cirrhosis in rat liver revealed the mechanism of thioacelamide hepatotoxicity 1
... containing biotin tags All cysteines labeled with heavy ICAT containing biotin tags Combine, optionally fractionate and proteolyze Affinity isolation (biotin-avidin) of ICAT labeled peptides Analysis ... (Cell mapping proteomics) Protein-protein interaction is another important facet of proteomics Other than abundance, structure and localization, the interacting partner of a prot...
Ngày tải lên: 16/09/2015, 17:14
Demonstration of specific dust mite allergen induced response in a murine model
... relevant than ovalbumin which is the standard antigen used in murine models of atopic asthma There is also a lack of animal models using dust mite allergens as the allergen source (Sharma et al., ... these allergens interact in a host system was investigated using responder animals in the context of modeling atopic asthma 3.3 Murine model of dust mite allerg...
Ngày tải lên: 04/10/2015, 10:26
Investigation of blast induced neurotrauma in a rodent models
... Overview of Traumatic Brain Injury Traumatic brain injury (TBI) is one of the foremost causes of disability and death in both civilian settings and theatres of war TBI can be simply defined as damage ... 2g Blast (green) and 5g BA (blue) Animals were trained to attain ≥80% baseline accuracy No significant difference was found for both g and g BA from baseline scores and sham anima...
Ngày tải lên: 08/11/2015, 17:00