A particle swarm optimisation based grey prediction model for thermal error compensation on CNC machine tools

... approach Section presents a novel unified graph- based model for opinion retrieval We evaluated our model and the results are presented in Section We review related works on opinion retrieval in Section ... query-independent opinion score of all retrieved Unified Opinion Retrieval Model In addition to conventional 2-stage approach, there has been some research on unified...

Ngày tải lên: 20/02/2014, 04:20

... minimal then 8: Update bracketing instances for index j 9: end if 10: end if 11: end for 12: for each j ∈ c := ∪ {bracketing instances from j} 13: 14: end for 15: Output: bracketing instances We ... the parse tree 3.3 The Integration of the SDB Model into Phrase-Based SMT We integrate the SDB model into phrase-based SMT to help decoder perform syntax-driven phrase trans...

Ngày tải lên: 20/02/2014, 07:20

... Therefore, the models used in spelling correction are inadequate for providing a complete solution for SMS normalization 2.3 SMS Normalization versus General Text Normalization General text normalization ... pre-processing work for an English-toChinese SMS translation system using a wordgroup model In addition, in most of the commercial SMS translation applications , SMS...

Ngày tải lên: 20/02/2014, 12:20

... Probabilistic models for segmenting and labeling sequence data In Proceedings of ICML-01, pages 282289 Franz-Josef Och, Christoph Tillmann, and Hermann Ney 1999 Improved Alignment Models for Statistical Machine ... of support vector machines (SVM) However, Eq is more suitable for non-separable problems (which is often the case for SMT) since it directly models the conditional prob...

Ngày tải lên: 20/02/2014, 15:20

... b2 Maximum Entropy Based Reordering Model b1 c1 source In this section, we discuss how to create a maximum entropy based reordering model As described above, we defined the reordering model Ω on ... flexible It makes our model reorder any blocks, observed in training or not The whole maximum entropy based reordering model is embedded inside a log-linear phrase -b...

Ngày tải lên: 08/03/2014, 02:21

... conjugated forms of verbs Syllable statistics have been also used for automatic word spacing (Shim, 1996; Kang and Woo, 2001; Lee et al., 2002) The syllable based word recognition model is represented ... data suitable for the word recognition model The corpus can be modied through the following steps: Step For a given Eojeol, segment word boundaries and assign wo...

Ngày tải lên: 17/03/2014, 06:20

... compare the performance of different text representation models for event detection, namely BurstVSM and boostVSM (He et al., 2007b; He et al., 2007a).7 For different representation models, we use ... proposed methods are both effective and efficient Burst-based Text Representation In this section, we describe the proposed burst-based text representation model, denoted...

Ngày tải lên: 23/03/2014, 14:20

... 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense primer, 5Â-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3Â; 2.5I antisense primer, 5Â-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ... claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3Â, was synthesized by Oper...

Ngày tải lên: 30/03/2014, 04:20

... Acknowledgements We are grateful to Drs David Wenkert and Yuehai Shen for 17AAG characterization and to Drs Jacob Zhang and Kyle Furge for statistical analysis We thank Michelle Bassett for assistance in ... highly invasive into the brain parenchyma and rarely fully resectable Xenograft mouse models for human GBM inadequately recapitulate the human disease because of slow grow...

Ngày tải lên: 18/06/2014, 15:20

... monopole antenna using a particle swarm optimization approach,” IEEE Transactions on Antennas and Propagation, vol 53, no 10, pp 1–7, 2005 [24] J Robinson and Y Rahmat-Samii, Particle swarm optimization ... Ho, A S Madhukumar, and F Chin, “Peak-to-average power reduction using partial transmit sequences: a suboptimal approach based on dual layered phase sequencing,”...

Ngày tải lên: 21/06/2014, 23:20

... use of medical services for elderly people and ability to meet of commune health stations in Binh Duong Province, 2010 4.1.1 On the demand, access to and use of medical services for elderly people ... meet of commune health centers in Binh Duong province, in 2010 - Health care needs of elderly people in Binh Duong Province we...

Ngày tải lên: 25/07/2014, 14:07

... of the model for those seeking an evidence-based approach to health workforce and health services planning The South Australian Department of Health is already using the WEB model to inform the ... article as: Segal and Leach: An evidence-based health workforce model for primary and community care Implementation Science 2011 6:93 Submit your next manuscript...

Ngày tải lên: 10/08/2014, 11:20

... Endocrinol Metab 2003, 88:742-747 72 Nomura M, Shichiri M, Kawamori R, Yamasaki Y, Iwama N, Abe H: A mathematical insulin- secretion model and its validation in isolated rat pancreatic islets perifusion ... comparison Oxygen dependence Because oxygen diffusion is a limiting factor in avascular islets, hypoxia can limit insulin secretion The oxygen dependence of local...

Ngày tải lên: 13/08/2014, 16:20

... construct an adaptive image model based on the line field model  To examine the proposed model s performance for image restoration by using it for the denoising problem  To solve the deblurring ... variant distributed line field is called LiFeAIM, which stands for Line Field based Adaptive Image Model We use the model in a denoising algorithm to ex...

Ngày tải lên: 11/09/2015, 10:06

... prediction model One of the difficult issues in thermal error modelling is the selection of appropriate locations for the temperature sensors, which is a key factor in the accuracy of the thermal error ... discussion In this section, the aim is to use the structure of the ANFIS models described in the previous section to derive a thermal error com...

Ngày tải lên: 26/09/2015, 12:04