... cells and incubated with a circular plasmid as the substrate DNA The substrate plasmid DNA was 5381 Mitochondria in nuclear death of Tetrahymena T Kobayashi and H Endoh B A C Fig Mitochondrial nuclease ... phosphatase activity was higher in fractions and than in fraction (Table 1) These results indicate that fraction contains a significant number of mitoc...
Ngày tải lên: 20/02/2014, 03:20
... Strategy for the Management and Disposal of Used Nuclear Fuel and High-Level Radioactive Waste INTRODUCTION AND SUMMARY The Strategy for the Management and Disposal of Used Nuclear Fuel and High-Level ... Management and Disposal of Used Nuclear Fuel and High-Level Radioactive Waste generators pay the full cost of...
Ngày tải lên: 21/02/2014, 21:20
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
... Isotope effects and their pH dependence in MAO A pH pH Fig (A, B) pH dependence of the steadystate kinetic parameters of MAO A- catalysed oxidation of kynuramine at 20 °C (C, D) pH dependence of the ... steady-state kinetic parameters of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S2 pH dependence of the reductive half-reaction o...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA- PBAD-R OMCB- PBAD-F OMCB- PBAD-R 3736 controlled by an arabinose promoter [26], was achieved...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... mansoni NR1 A B W Wu et al DNA binding domain Ligand binding domain Fig Sequence alignment (A) Alignment of DNA binding domain (C domain) and its C-terminal extension (B) Alignment of ligand binding ... assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesoc...
Ngày tải lên: 07/03/2014, 11:20
Temperature dependence of the quality of silicon nanowires produced over a titania supported gold catalyt
... both, the bare catalyst and the product may generate Raman bands, the spectra of a reference silicon wafer and that of the fresh catalyst are included in the figure The spectrum for the fresh catalyst ... quantitative comparison of the density of SiNW left on the catalyst surface after reaction at different temperatures, the Fig SEM micrograph of silicon nan...
Ngày tải lên: 16/03/2014, 15:09
Báo cáo "The dependence of the nonlinear absorption coefficient of strong electromagnetic waves caused by electrons confined in rectangular quantum wires on the temperature of the system" doc
... expressions of the nonlinear absorption coefficient of a strong EMW by confined electrons in RQWs with infinite potential (Eq.9 and Eq.10), we see that the dependence of the nonlinear absorption coefficient ... Journal of Science, Mathematics - Physics 26 (2010) 115-120 show the dependence of the nonlinear absorption coefficient of a stro...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo " The dependence of the parametric transformation coefficient of acoustic and optical phonons in doped superlattices on concentration of impurities" pot
... transformation coefficient on concentration of impurities when concentration of impurities nD tend toward zero, value of the parametric transformation coefficient of acoustic and optical phonons in doped superlattices ... of acoustic and optical phonons in doped superlattices depends non-linearly on concentration of impurities nD E...
Ngày tải lên: 22/03/2014, 11:20
Đề tài " (log t)2/3 law of the two dimensional asymmetric simple exclusion process " pdf
... Annals of Mathematics, 159 (2004), 377–405 (log t)2/3 law of the two dimensional asymmetric simple exclusion process By Horng-Tzer Yau* Abstract We prove that the diffusion coefficient for the two dimensional ... that the result and method in this paper apply to all asymmetric simple exclusion processes; the special choice is made to simplify the not...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: "Syntactic Dependence and the Computer Generation of Coherent Discourse" pdf
... are as follows: The head of the main verb phrase of a sentence or clause is dependent upon the head of the subject The head of a direct object phrase is dependent upon the head of the governing ... upon the head of the verb phrase in which they appear Two-way dependency exists between the head of a phrase and any form of the verb "to be" or the prepos...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo "Dependence of glow curve structure on the concentration of dopants in LiF:Mg,Cu,Na,Si thermoluminescent material " ppt
Ngày tải lên: 28/03/2014, 13:20
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
... series of aggregation states, e.g the amyloidogenic nucleus and other prefibrillar intermediates, culminating in formation of the mature fibril [24] The increasing a-Crystallin and amyloid fibril formation ... from the start of the experiment By the end of the measurement, the thickness had increased by 0.342 nm, the mass had increased by 0.10...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Regulation of the muscle-specific AMP-activated protein kinase a2b2c3 complexes by AMP and implications of the mutations in the c3-subunit for the AMP dependence of the enzyme docx
... presence of AMP (0, 50, 200 or 500 lM AMP) Table Effect of the mutations in the AMPK c3 gene on the AMP dependence of the enzyme Fold stimulation reflects the activation of the corresponding AMPK complexes ... AICAR- and contraction-induced a2-AMPK signaling [49] Initially, AMP was thought to increase phosphorylation of AMPK by AMPKK both by direct...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx
... during the assembly of the head of bacteriophage T4 Nature 227, 680–685 43 Ogawa, K., Tashima, M., Yumato, Y., Okuda, T., Sawada, H., Okuma, M & Maruyama, Y (1990) Coding sequence of human placenta ... were able to demonstrate that this was the case for both ADP and ATP–actin (not Fig Effect of pH on the interaction of actin with cofilin (A) Effect of pH on the interact...
Ngày tải lên: 31/03/2014, 09:20
scientific american special online issue - 2002 no 03 - the science of war - nuclear history
... 1988 The Science of War: Nuclear History COPYRIGHT 2002 SCIENTIFIC AMERICAN, INC SCIENTIFIC AMERICAN SPECIAL ONLINE ISSUE originally published Auguest 1995 Recollections of a Nuclear War Two nuclear ... THE SCIENCE OF WAR: NUCLEAR HISTORY ScientificAmerican.com special online issue no The unleashed power of the atom has changed everyth...
Ngày tải lên: 12/05/2014, 16:31