dna barcoding gene cytochrome c oxidase subunit i of channa species in the mekong delta

Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

... cross-react with antibodies against plant helicases including PDH45 and PDH65 and also against human DNA helicases I, II, III and IV (data not shown) ssDNA-dependent ATPase activity was present at a ... helicase have been shown to play a role in DNA Ó FEBS 2003 A novel nuclear DNA helicase from Pisum sativum (Eur J Biochem 270) 1743 Fig Effect of DNA interacti...

Ngày tải lên: 20/02/2014, 11:20

11 574 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

... suppression of respiration during hypoxia In the absence of differential regulation of a speci c nuclear gene coding for the subunits of CytOX, changes in the microenvironment of the cell may induce alterations ... modulates the expression of mRNAs for CytOX subunits and also the catalytic activity of the enzyme complex Our results show tha...

Ngày tải lên: 20/02/2014, 23:20

9 555 0
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc

Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc

... within )260/)119, we Ó FEBS 2002 Integrin a3 gene promoter (Eur J Biochem 269) 4529 Fig Effects of mutations in the Ets- and GATA-binding sites and the E-box of the mouse a3 integrin gene on promoter ... assay (EMSA) using the Ets consensus site at )133 As the involvement of the Ets consensus binding site at )133 in the promoter activity of th...

Ngày tải lên: 21/02/2014, 03:20

9 562 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt

Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt

... bacteria, such as E coli, the System I cytochrome c biogenesis machinery, consisting of some disulfide bond formation (Dsb) and cytochrome c maturation (Ccm) proteins, is responsible for the biogenesis ... expression in E coli strains with reference to PH c5 52, which has been characterized as a System I -dependent cytochrome c Biogenesis of cytochrom...

Ngày tải lên: 06/03/2014, 00:20

8 607 0
Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

... Specificity of cytochrome c biogenesis System II System I Disulfide isomerization Heme handling/ligation Fig Schematic representation of cytochrome c biogenesis Systems I and II The systems illustrated ... analysis, and subsequent heme staining of the gel, of periplasmic fractions from cells expressing P denitrificans cytochrome c5 50 and the indic...

Ngày tải lên: 06/03/2014, 09:22

12 469 0
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

... GGT CTC CCATG GCA ATG AGG GCT GCG GGT G-3¢; HCV-1b Core+1/S sense, 5¢-ATC CGG GGT CTC CCATG GCA ATG AGG GCC TGG GGT G-3¢; HCV-1a Core+1/S antisense, 5¢-AT CCG GGT CTC GGTACC TTA TCA CGC CGT C TT ... Darbon H, Canard B, Finet S & Longhi S (2005) The intrinsically disordered C- terminal domain of the measles virus nucleoprotein interacts with the C- terminal domain of the phos...

Ngày tải lên: 15/03/2014, 09:20

16 498 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

... establish a three -domain- structure for the a- subunit consisting of the N-terminal carboxyltransferase domain and the C-terminal biotin-binding domain which are connected by the association domain ... formation between the a- and c-subunits and dissociation at acidic pH A detailed analysis of the interaction of the C-terminal domain of the c-subunit...

Ngày tải lên: 23/03/2014, 13:20

10 333 0
Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx

Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx

... Disease -mutations in cytochrome oxidase (Eur J Biochem 270) 1223 Fig Location of disease-related mutations in the catalytic core of cytochrome oxidase The structure has been drawn from the co-ordinates ... effect of the mutations on the function and assembly of the catalytic core of cytochrome oxidase Table Disease-related mutations in the mitochondrially encod...

Ngày tải lên: 23/03/2014, 21:20

9 318 0
Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx

Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx

... AGTCTATTCTCGAGGGGGCGGGCGCCCGCACTCAG AGTCTATTCTCGAGCGCGACCTGGGTCTGCCCAG GGCCGCCCCAGCGTGGTTACGACCTGCTTCGGCAGG GCGTGG GCCTTTCTCGGGGCCGCTTCAGCGTGGGAACG GGCGCCCGCCCCCGGCCATACCACAGCCTTTCTCGG GCGGGCGCCCGAACCCTGCCCGCCCCACA ... GCTGAAGACCGCGGAGGTAC GAGGTACCCAGAACTGCCCTG GATAGTCAGTGGGGGAAACCTCAG CAGCAAAAGAGGGCTGTGTGGTG TGGCCGCCACGAACATCCCATC GTTGCCCAGGTTGGAGTGCAG CTCGCGGGCTCGGCAGTGGGAG AGTCTATTCTCGAGCA...

Ngày tải lên: 30/03/2014, 03:20

12 333 0
Báo cáo khoa học: Probing the access of protons to the K pathway in the Paracoccus denitrificans cytochrome c oxidase pdf

Báo cáo khoa học: Probing the access of protons to the K pathway in the Paracoccus denitrificans cytochrome c oxidase pdf

... B, Michel H & Mantele W ¨ 411 Proton access to Paracoccus cytochrome c oxidase 23 24 25 26 27 28 29 30 (1998) Involvement of glutamic acid 278 in the redox reaction of the cytochrome c oxidase ... denitrificans aa3 cytochrome c oxidase FEBS Journal 272 (2005) 404–412 ª 2004 FEBS Proton access to Paracoccus cytochrome c oxidase E78II does not repr...

Ngày tải lên: 30/03/2014, 15:20

9 367 0
Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt

Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt

... [18] The data were collected at 250 K in the presence of low concentrations of cytochrome c plus TMPD and ascorbate As the concentration of cytochrome c is increased, the fraction of cytochrome ... catalytic cycle of reduction of CCO by cytochrome c Mitchell and Rich [47] proposed that two protons were taken up on reduction of CCO and that these...

Ngày tải lên: 31/03/2014, 07:20

8 343 0
Báo cáo y học: " Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia" pot

Báo cáo y học: " Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia" pot

... fusion gene and C-terminus extension length of haemagglutininneuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia Virology Journal 2010 7:183 Submit your next manuscript ... molecular characterization of F and C-terminus extension length of HN protein genes of recently isolated Malaysian isolates and the...

Ngày tải lên: 12/08/2014, 04:20

10 464 0
Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells

Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells

... treated CEM /Bcl- 2 cells Indeed, if MnSOD was engaged in blunting mitochondrial O2- increase in antimycin-treated CEM /Bcl- 2 cells due to increased activity in the context of Bcl- 2 overexpression, ... a conformational change in Bcl- 2, exposing its BH3 domain, converting Bcl- 2 from anti-apoptotic to pro-apoptotic (Lin, Kolluri et al 20 04) 1.6 Non-canonical...

Ngày tải lên: 14/09/2015, 08:42

78 267 0
dna barcoding gene cytochrome c oxidase subunit i of channa species in the mekong delta

dna barcoding gene cytochrome c oxidase subunit i of channa species in the mekong delta

... in COI barcoding gene with C striata This finding is similar to the result of studies on square head climbing perch and climbing perch in the Mekong Delta of Vietnam These strains of climbing ... classification, DNA barcoding, species diversity, morphology INTRODUCTION Channa species are among the most popular species in Viet Nam There are four species...

Ngày tải lên: 17/10/2015, 08:41

15 447 0
w