Timing analysis of concurrent programs running on shared cache multi cores

Reliability analysis of power system based on generalized stochastic petri nets

... interconnections symbolize the logical interactions The construction rule for each sub-block follows two steps: 1) Identiﬁcation and description of states (conﬁgurations); 2) Speciﬁcation of transitions ... the stochastic transitions were supposed to have constant probability of ﬁring However, there is a strong correlation between the operating conditions of power systems and the probability of harmful ... marking of auxiliary place M (ps ), are reported in Table III Since we decided to condition only the transition T PU T of the protection of line L1 , then we only need the information contained...

Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

... Journal compilation ª 2007 FEBS 6271 ETD -MS analysis of peptides and proteins N D Udeshi et al dimethylation of Arg, monomethylation, dimethylation and trimethylation of Lys, acetylation and ubiquitination ... resulting radical anion abstracts a proton and generates a radical site that triggers dissociation to produce a complementary pair of fragment ions of type c¢ and z¢Æ Subtraction of the m ⁄ z values ... ETD -MS analysis of peptides and proteins charged) indicates that the Tyr residues at positions 31 and 40 are both 80 mass units higher in mass than expected and are therefore phosphorylated Analysis...

Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

... W16 5A W16 9A W17 8A L6 6A R6 7A R6 8A D6 9A I7 0A K7 2A C7 3A S16 2A I163Ab Y16 4A E16 6A D16 7A P16 8A R17 0A G17 2A R6 2A ⁄ K6 3A R6 7A ⁄ R6 8A R6 7A ⁄ R6 8A ⁄ K7 2A K15 9A ⁄ K16 0A a )MgCl2 ss Normal conditiona ss ... ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular ssDNA (New England BioLabs, MA, USA) were ... Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous- pairing activity of the human DNA-repair proteins Xrcc3.Rad51C Proc Natl Acad Sci USA 98, 5538–5543 20 Kagawa W, Kurumizaka H, Ikawa...

An Analysis of Database Workload Performance on Simultaneous Multithreaded Processors potx

... optimizations for improving TPC-C performance on Digital AlphaServers Conclusions This paper explored the behavior of database workloads on simultaneous multithreaded processors, concentrating ... (including modelling of I/O), and synchronization The database workload On- line transaction processing (OLTP) and decision support systems (DSS) dominate the workloads handled by database servers; ... commercial workloads In 25th Ann Int’l Symp on Computer Arch., June 1998 [3] Z Cvetanovic and D Bhandarkar Characterization of Alpha AXP performance using TP and SPEC workloads In 21st Ann Int’l Symp on...

Axel simon value range analysis of c programs

... Microsoft Windows, we deﬁne the notion of correct memory management The chapter concludes by stating the concrete semantics of Core C from which a collecting semantics is derived 2.1 Core C The ... Value- Range Analysis of C Programs Axel Simon Value- Range Analysis of C Programs Towards Proving the Absence of Buffer Overﬂow Vulnerabilities 123 Axel Simon ISBN: 978-1-84800-016-2 ... Semantics for C the end of each basic block This simplistic structure allows a complete yet concise deﬁnition of the semantics of Core C, thereby providing a foundation for a sound static analysis...

Techno-Economic Analysis of Biofuels Production Based on Gasification docx

... Techno-Economic Analysis of Biofuels Production Based on Gasification Ryan M Swanson, Justinus A Satrio, and Robert C Brown Iowa State University Alexandru Platon ConocoPhillips ... a tax of approximately $90 per metric ton of carbon A more recent study by Larson et al of switchgrass-to-hydrocarbons production in 2009 reports a production cost of $15.3/GJ ($1.90/gal of gasoline) ... tpd) plant based on gasification [38] Table compares four biofuel production studies based on gasification A range of cost year, plant size, and feedstock cost show the diversity of characteristics...

Báo cáo hóa học: " Morphology Analysis of Si Island Arrays on Si(001)" doc

... the stronger the intensity at the corresponding position in the Nu(m) distribution The polar plots conﬁrm that most of the island sidewall facets in the arrays lie along the x and y axes of the ... that play a key role on the formation of these Si island arrays, we have carried out a detailed study of their morphology features, in particular island size and facet distribution Taking into account ... {113} facets) on one side and 35° (i.e., {112} facets) on the other side There is an asymmetry then between opposite sides of the islands as well (along the y axis), being more pronounced for...

Báo cáo hóa học: " Statistical Analysis of Surface Reconstruction Domains on InAs Wetting Layer Preceding Quantum Dot Formation" pot

... (1x3)/(2x3) domains (2x4) domains Ordered pattern Envelope of Poisson patterns Fig Nearest neighbor distance function p(t) of surface reconstruction domains on InAs WL as well as that of typical ... cm-2) of InAs QD precursors nucleating afterward, it implies the possibility that a QD formation pattern is based on the distribution of surface reconstruction domains [3] The standard deviation of ... in Fig A set of these cells correspond to a surface reconstruction domain extending for 16 nm2 For each of (1 3)/(2 3) and (2 4) surface reconstructions, the center points of the domains were...

Báo cáo hóa học: " Research Article Geometry Unit for Analysis of Warped Image Features on Programmable Chips" ppt

... The GEO unit features backward transformation and interpolation of the arbitrarily formed image regions In this context, a region is deﬁned as a set of points Therefore, a speciﬁc region is described ... Rectiﬁcation of a general linear deformation with three tie-points APPLICATION OF THE GEOMETRY UNIT FOR TIE-POINT SEARCH Localization of typical patters (templates) within an image is a common (sub)task ... transformation can be of interest for some applications, for example, to rectify perspectival deformations as they appear in images of cylindrical objects (iii) The geometry unit processes one...

Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx

... (1974)  As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder  As the cylinder spacing increases, the wave force on the cylinders ... Remarks  The wave forces acting on two cylinders and three cylinders are computed by using boundary element method The numerical results are in good agreement with those of Chakrabarti (1978) and ... xạ(Diffraction phenomenon)  As an incident wave impinges on the cylinder, a reflected wave moves outward On the sheltered side of the cylinder there will be a “shadow” zone where the wave fronts are...

Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

... lack of activation and expression of CD38 and HLA-DR on CD4+ T cells correlates with long-term non-progression [9] The enumeration of CD4+ T- lymphocytes by flow cytometry is used routinely in the ... infection [41] These findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those from other HIV+ individuals CD16 expression ... previously reported findings from flow cytometric investigations, but also demonstrated the power of the antibody microarray technology, by identifying new cell surface antigens that may potentially...

Báo cáo y học: "Longitudinal microarray analysis of cell surface antigens on peripheral blood mononuclear cells from HIV+ individuals on highly active antiretroviral therapy" doc

... therapy by flow cytometry, this study is the first to use a cell- based antibody microarray (135 antigens) to retrospectively and longitudinally monitor the effect of antiretroviral therapy on cell ... Dwyer DE, Saksena NK: Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages Retrovirology 2007, 4(1):83 Woolfson ... expensive if done by flow cytometry Secondly, the detections of cell surface antigens in our study lay a solid foundation for future functional assessment of these markers The differential antigens...

Báo cáo y học: "An updated study-level meta-analysis of randomised controlled trials on proning in ARDS and acute lung injury" pps

... setting of early studies on prone ventilation, ecological bias consisted of variable prone duration, mixed severity of acute lung injury, variable time-lapse between lung injury onset and inclusion, ... patients (ARDS only, excluding acute lung injury (ALI) non -ARDS patients), and control for the most relevant confounders - that is, proning duration (usually >17 hours/day) and use of lung- protective ... towards an interaction between longer proning duration and reduction in mortality The initial studies by Guerin and colleagues [2] and Gattinoni and colleagues [1] had the greatest impact on...

Báo cáo y học: "GOToolBox: functional analysis of gene datasets based on Gene Ontology" pptx

... GO -based web -analysis programs Its two unique features, GO-Proxy and GO-Family, enable new kinds of analyses to be carried out, based on the functional annotations of gene datasets These new functionalities ... statistical analysis of terms associated with gene sets (GO-Stats), GO -based gene clustering (GO-Proxy), and gene retrieval based on GO annotation similarity (GO-Family) Recently, several web -based ... a given gene set, compared to the distribution of these terms among the annotations of the complete genome? Second, among a particular gene set, are there closely functionally related gene subsets?...

Timing analysis of concurrent programs running on shared cache multi cores

... Section and literature review in Section From section 4, we list our primary contributions devoted to timing analysis for concurrent software running on multi- cores with a shared instruction cache ... shared cache multi- cores, one program thread may have constructive or destructive effect on another in terms of cache hits/misses This makes the timing analysis of concurrent programs running on shared- cache ... thesis, we develop a timing analysis method for concurrent software running on multi- cores with a shared instruction cache We not handle data cache, shared memory synchronization and code sharing...

Xem thêm

Từ khóa: analysis of supreme court decision on aca the swot analysis of chw programs timing analysis of can based automotive communication systems 8 methods for analysis of o linked modifications on epidermal growth factor like and thrombospondin type 1 repeats energy analysis of a system with on off type capacity control box 8 1 malpractice figures from american medical association analysis of claims filed based on 1 design measurement and analysis of cardiovascular dynamics based on labview performance analysis of parallel programs sediment—analysis of potential adverse effects on benthic organisms fish—analysis of potential adverse effects on fish eating wildlife shellfish—analysis of potential adverse effects on human health corpus analysis of english research articles on economics corpus analysis of vietnamese research articles on economics analysis of denialofservice attacks on wireless sensor networks using simulation note on the implementation and monitoring of livelihood programs Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ