... interconnections symbolize the logical interactions The construction rule for each sub-block follows two steps: 1) Identification and description of states (configurations); 2) Specification of transitions ... the stochastic transitions were supposed to have constant probability of firing However, there is a strong correlation between the operating conditions of power systems and the...
Ngày tải lên: 03/01/2014, 19:35
... Journal compilation ª 2007 FEBS 6271 ETD -MS analysis of peptides and proteins N D Udeshi et al dimethylation of Arg, monomethylation, dimethylation and trimethylation of Lys, acetylation and ubiquitination ... resulting radical anion abstracts a proton and generates a radical site that triggers dissociation to produce a complementary pair of fragment ions of...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx
... W16 5A W16 9A W17 8A L6 6A R6 7A R6 8A D6 9A I7 0A K7 2A C7 3A S16 2A I163Ab Y16 4A E16 6A D16 7A P16 8A R17 0A G17 2A R6 2A ⁄ K6 3A R6 7A ⁄ R6 8A R6 7A ⁄ R6 8A ⁄ K7 2A K15 9A ⁄ K16 0A a )MgCl2 ss Normal conditiona ss ... ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 cir...
Ngày tải lên: 06/03/2014, 09:22
An Analysis of Database Workload Performance on Simultaneous Multithreaded Processors potx
... optimizations for improving TPC-C performance on Digital AlphaServers Conclusions This paper explored the behavior of database workloads on simultaneous multithreaded processors, concentrating ... (including modelling of I/O), and synchronization The database workload On- line transaction processing (OLTP) and decision support systems (DSS) dominate the workloads handled...
Ngày tải lên: 07/03/2014, 14:20
Axel simon value range analysis of c programs
... Microsoft Windows, we define the notion of correct memory management The chapter concludes by stating the concrete semantics of Core C from which a collecting semantics is derived 2.1 Core C The ... Value- Range Analysis of C Programs Axel Simon Value- Range Analysis of C Programs Towards Proving the Absence of Buffer Overflow Vulnerabilities 123 Axel Simo...
Ngày tải lên: 19/03/2014, 14:05
Techno-Economic Analysis of Biofuels Production Based on Gasification docx
... Techno-Economic Analysis of Biofuels Production Based on Gasification Ryan M Swanson, Justinus A Satrio, and Robert C Brown Iowa State University Alexandru Platon ConocoPhillips ... a tax of approximately $90 per metric ton of carbon A more recent study by Larson et al of switchgrass-to-hydrocarbons production in 2009 reports a production cost of $15.3/GJ ($1.90/ga...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo hóa học: " Morphology Analysis of Si Island Arrays on Si(001)" doc
... the stronger the intensity at the corresponding position in the Nu(m) distribution The polar plots confirm that most of the island sidewall facets in the arrays lie along the x and y axes of the ... that play a key role on the formation of these Si island arrays, we have carried out a detailed study of their morphology features, in particular island size and facet distri...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Statistical Analysis of Surface Reconstruction Domains on InAs Wetting Layer Preceding Quantum Dot Formation" pot
... (1x3)/(2x3) domains (2x4) domains Ordered pattern Envelope of Poisson patterns Fig Nearest neighbor distance function p(t) of surface reconstruction domains on InAs WL as well as that of typical ... cm-2) of InAs QD precursors nucleating afterward, it implies the possibility that a QD formation pattern is based on the distribution of surface reconstruction dom...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Research Article Geometry Unit for Analysis of Warped Image Features on Programmable Chips" ppt
... The GEO unit features backward transformation and interpolation of the arbitrarily formed image regions In this context, a region is defined as a set of points Therefore, a specific region is described ... Rectification of a general linear deformation with three tie-points APPLICATION OF THE GEOMETRY UNIT FOR TIE-POINT SEARCH Localization of typical patters (templates) with...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx
... (1974) As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave force on the cylinders ... Remarks The wave forces acting on two cylinders and three cylinders are computed by using boundary element method The numerical r...
Ngày tải lên: 26/07/2014, 07:20
Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt
... lack of activation and expression of CD38 and HLA-DR on CD4+ T cells correlates with long-term non-progression [9] The enumeration of CD4+ T- lymphocytes by flow cytometry is used routinely in the ... infection [41] These findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those from...
Ngày tải lên: 13/08/2014, 05:22
Báo cáo y học: "Longitudinal microarray analysis of cell surface antigens on peripheral blood mononuclear cells from HIV+ individuals on highly active antiretroviral therapy" doc
... therapy by flow cytometry, this study is the first to use a cell- based antibody microarray (135 antigens) to retrospectively and longitudinally monitor the effect of antiretroviral therapy on cell ... Dwyer DE, Saksena NK: Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages Retro...
Ngày tải lên: 13/08/2014, 06:20
Báo cáo y học: "An updated study-level meta-analysis of randomised controlled trials on proning in ARDS and acute lung injury" pps
... setting of early studies on prone ventilation, ecological bias consisted of variable prone duration, mixed severity of acute lung injury, variable time-lapse between lung injury onset and inclusion, ... patients (ARDS only, excluding acute lung injury (ALI) non -ARDS patients), and control for the most relevant confounders - that is, proning duration (usually >17 hou...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "GOToolBox: functional analysis of gene datasets based on Gene Ontology" pptx
... GO -based web -analysis programs Its two unique features, GO-Proxy and GO-Family, enable new kinds of analyses to be carried out, based on the functional annotations of gene datasets These new functionalities ... statistical analysis of terms associated with gene sets (GO-Stats), GO -based gene clustering (GO-Proxy), and gene retrieval based on GO annotation sim...
Ngày tải lên: 14/08/2014, 14:21
Timing analysis of concurrent programs running on shared cache multi cores
... Section and literature review in Section From section 4, we list our primary contributions devoted to timing analysis for concurrent software running on multi- cores with a shared instruction cache ... shared cache multi- cores, one program thread may have constructive or destructive effect on another in terms of cache hits/misses This makes the timing analysis...
Ngày tải lên: 16/10/2015, 15:38