... where eelgrass plants were collected, the Yoshina Tidal Flat in Seto Inland Sea, which has well-established eelgrass beds Resistance to uprooting forces The resistance to uprooting forces of the eelgrass ... ability of slag to anchor the roots of the eelgrass plants and (3) to investigate how sedimentation of fine particles affects anchoring of the...
Ngày tải lên: 05/09/2013, 09:38
... Art and Practice of Court Administration, Alexander B Aikman 130 Handbook of Globalization, Governance, and Public Administration, edited by Ali Farazmand and Jack Pinkowski 131 Handbook of Globalization ... 4:02:59 PM Ⅲ Handbook of Long-Term Care Administration and Policy Early History Local Government Contracting for Provision of Care: Outdoor Relief A com...
Ngày tải lên: 15/02/2014, 19:20
Báo cáo khoa học: Identification of the amniotic fluid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms docx
... degradation of IGFBP-1 isoforms The y-axis shows the percentage of the ratio between the spot area of the degraded and that of the untreated protein measured using IMAGE J 1.37V software the presence of ... almost to the same extent as the unmodified protein and that the susceptibility to proteolytic degradation of the isoforms increased with the...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx
... synthase, phosphofructokinase 2, ceramide synthesis, glucose uptake, apoptosis, insulin receptor substrate 1, mammalian target of rapamycin kinase (mTOR), mitogen-activated protein kinase kinase 3, ... blocked inactivation of the AMPK by insulin (Fig 7), suggesting a dominance of the fatty acid-driven pathway for activation of AMPK over at least some aspects of insulin sig...
Ngày tải lên: 07/03/2014, 15:20
Chernobyl’s Legacy: Health, Environmental and Socio-Economic Impacts and Recommendations to the Governments of Belarus, the Russian Federation and Ukraine pdf
... to the Governments of Belarus, the Russian Federation and Ukraine The Chernobyl Forum: 2003–2005 Second revised version Table of Contents Summary Chernobyl’s Legacy: Health, Environmental and Socio-Economic ... Consequences 21 The Socio-Economic Impact of the Chernobyl Nuclear Accident 32 Recommendations to the Governments of Belarus, t...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I pot
... collected and analyzed by SDS/PAGE In vitro self-cleavage of S pneumoniae SPase I For in vitro self-cleavage of S pneumoniae SPase I in the presence of phospholipid, 20 lL of reaction containing lg of ... dramatic decrease of the enzymatic activity, implying that the self-cleavage, if occurring in vivo, may play an important role in the regulation of...
Ngày tải lên: 23/03/2014, 21:21
báo cáo hóa học: " Testing a model of association between patient identified problems and responses to global measures of health in low back pain patients: a prospective study" pdf
... this model by undertaking a series of analyses to determine the associations between the two individualised items and measures of "overall improvement", "general health status" and performance of ... programme of spinal manual physiotherapy in the treatment of non-specific low back pain of less than Q1 During the baseline assessment, the following question...
Ngày tải lên: 18/06/2014, 19:20
when genius failed the rise and fall of long term capital management roger lowenstein
... in Long- Term Capital For a moment the bankers, the cream of Wall Street, were silent And then the room exploded THE RISE OF LONG- TERM CAPITAL MANAGEMENT MERIWETHER IF THERE WAS one article of ... Note and Acknowledgments Introduction THE RISE OF LONG- TERM CAPITAL MANAGEMENT • Meriwether • Hedge Fund • On the Run • Dear Investors • Tug -of- War...
Ngày tải lên: 20/07/2014, 21:25
Báo cáo khoa học: "Physiological and pathological aspects of long-term storage of acorns" potx
... high standards required for seed storage today and In the context of a long-term storage project at the University of Hannover, the physiological development during storage and germination of different ... for the development of seed -storage methods The current rule of thumb is that a water content of 40% and a temperature of -4 °C are the minima acorns require t...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo lâm nghiệp: " Effects of long-term water stress on net photosynthesis, growth and water-use efficiency of conifers in the field" doc
... (1987b) The influence of constant long-term water stress on 7-26 Larcher W (1960) Transpiration and photosynthesis of detached leaves and shoots of Quer cus pubescens and Q ilex during desiccation ... they take seasonal changes in daylength into marily consideration Thus, the reduction in net was photosynthesis was always greater on long and sunny summer days...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Primers and probes 11 β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: A...
Ngày tải lên: 09/08/2014, 08:22
báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx
... and health status, use of self-care and self-care support, and a set of validated measures on aspects of social capital and social support A second survey instrument was administered and audio-recorded ... Trusts and the University of Manchester and is part of the National Institute for Health Research The authors are members of the Patient Them...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: " Does respiratory health contribute to the effects of long-term air pollution exposure on cardiovascular mortality?" pot
... study, we investigated whether respiratory health at baseline contributes to the effects of longterm exposure to high levels of air pollution on cardiovascular mortality in this cohort of elderly ... between respiratory health and cardiovascular mortality [8-10] To what extent the association between cardiovascular mortality and air pollution is dri...
Ngày tải lên: 12/08/2014, 15:20
Pyrolysis and propensity to self ignition of long term low temperature wood chars
... 2.1.Introduction 2.2 .Self ignition 2.2.1 .Self ignition and gas-phase ignition 2.2.2 .Self ignition of wood materials 2.2.3 .Self ignition in limited oxygen conditions 11 2.3 .Pyrolysis of wood at low temperatures ... ignition Self ignition and piloted or auto -ignition of wood have totally different mechanism To research on the propensity of se...
Ngày tải lên: 16/10/2015, 15:36