Studies of new properties and applications of g quadruplex DNA

... differences in the stability of tethered and free sequences A Kinetics of human telomere quadruplex folding B Fig Thermodynamics of denaturation of human telomere quadruplex structures in buffered ... Form 1103 Telomeric quadruplex stability J B Chaires of the human telomeric quadruplex Similarly, unfolding of quadruplex forms requires only modest expendi...

Ngày tải lên: 06/03/2014, 09:22

... Development of Polyethylene Production Processes Morphology and Crystallization of Polyethylene Properties of Polyethylene Characterization and Testing The Chemistry of Polyethylene Orientation of Polyethylene ... types of ionomers can exhibit a noticeable taste and odor Cross-Linked Polyethylene The properties of cross-linked polyethylene depend very muc...

Ngày tải lên: 02/04/2014, 16:27

... Cheetham (Eds.) The Chemistry of Nanomaterials Synthesis, Properties and Applications in Volumes Volume Prof Dr C N R Rao CSIR Centre of Excellence in Chemistry and Chemistry and Physics of Materials ... nanowires and nanotubes, collections of these nanostructures in the form of arrays and superlattices are of vital interest to the science and technolog...

Ngày tải lên: 04/06/2014, 14:19

... ID1-2: x 29Si ID1-3: 12 x 13 C Assignments of E15/E16 ligand structure E15 -1: (5-5') 6.43 4.46 x 29Si (4-4') 3.89 4.08 E15-2: x 29Si (1- 1') 0.39 0.34 E15()-3: 5 -11 x 13 C + x 29Si (6-6') 13 . 71 ... Impurity Nc1 Nc2 Bc1 Bc2 Bh 2.0040 2.0037 2.0055 2.0062 2.0020 g 2.0026 2.0030 2.0045 2.0045 2.0068 g 1. 20 1. 19 0.22 0 .19 0 .19 A, mT 1. 20 1. 19 0 .13 0 .12 0 .15 A, mT EC...

Ngày tải lên: 20/06/2014, 04:20

... 23 , June 20 04, 23 520 2-1 -23 520 213, ISSN 1098-0 121 26 Properties and Applications of Silicon Carbide Bockstedte, M.; Gali, A.; Umeda, T.; Son, N.T.; Isoya, J & Janzen, E (20 06) Signature of the Negative ... constants Rp1 and Rp2 are projected ranges, and n1, n2, r1, r2, A1, A2, m1, and m2 are parameters related to the range stragglings ΔRp1 and ΔRp2, skewnesse...

Ngày tải lên: 20/06/2014, 04:20

... SiH3 (1) Si2H6 Si etching (Habuka et al., 2005): Si+3HCl Chlorination of SiH3: SiH3+3HCl  SiHCl3+ (5/2)H2 (6) 62 Properties and Applications of Silicon Carbide Chlorination of SiH3CH3: SiH3CH3+3HCl ... (1999) Growth of Ultrathin Epitaxial 3CSiC Films on Si(100) by Pulsed Supersonic Free Jets of CH3SiH3, Jpn J Appl Phys., 38 , L301 -30 3 76 Properties and Applicatio...

Ngày tải lên: 20/06/2014, 04:20

... FM- and AFM-ordered supercells containing a pair of TM 1 04 Properties and Applications of Silicon Carbide atoms This is the amount of energy needed to flip the spin of one of these atoms and ... the cases of SiC C-face and Si, which may cause the characteristics of the SiC Si-face oxidation to differ from those for SiC C-face and Si  84 Properties and...

Ngày tải lên: 20/06/2014, 04:20

... 0.4 0.3 0.2 1.4 0.1 1.2 25 35 45 f, GHz (a) 55 65 25 35 45 55 65 f, GHz (b) Fig The dispersion characteristics of the rectangular SiC waveguide: (a) – the dependence of the normalized phase constant ... stress that 126 Properties and Applications of Silicon Carbide the SiC waveguide operates in single-mode regime And the waveguide broadband width is approximately 2...

Ngày tải lên: 20/06/2014, 04:20

... a factor of 5x105 by varying the incident optical power  164 Properties and Applications of Silicon Carbide Fig 16 Admittance plots of illuminated SiC THz IMPATTs at 0.3 THz Silicon Carbide Based ... 161 162 Properties and Applications of Silicon Carbide Fig 13 Scanning-TEM of samples (a) with Ge & (b) without Ge The arrow in Fig 13(a) indicates a Ge layer...

Ngày tải lên: 20/06/2014, 04:20

... Technol., A1, 75 8 -76 1 Part Other applications: Electrical, Structural and Biomedical Properties and Applications of Ceramic Composites Containing Silicon Carbide Whiskers 1 97 X Properties and Applications ... side and tensile at the SiC side It is thus possible that some Ni atoms slightly penetrate into the SiC side at the interface with the 178 Properties an...

Ngày tải lên: 20/06/2014, 04:20

... percolation of the filler particles and the fractal nature of filler distribution in non- 204 Properties and Applications of Silicon Carbide whisker particulate composites and related it to the ac and ... breakage of interatomic bonds and frictional sliding also increase the work of fracture 210 Properties and Applications of Silicon Carbide One study...

Ngày tải lên: 20/06/2014, 04:20

... processes of C/SiC in terms of active and passive oxidation of silicon carbide Aerospace applications for silicon carbide Silicon carbide is defined by the Engineered Materials Handbook (Reinhart, 198 7) ... active oxidation of SiC and contemporary partial evaporation of SiO2 240 Properties and Applications of Silicon Carbide a b Fig SEM micrographs o...

Ngày tải lên: 20/06/2014, 04:20

... INVESTIGATION OF NEW PROPERTIES AND APPLICATIONS OF QUADRUPLEX DNA AND DEVELOPMENT OF NOVEL OLIGONUCLEOTIDEBASED TOPOISOMERASE I INHIBITORS WANG YIFAN (B.Sc., Soochow University, China) ... 1.3.1 Discovery of i- Motif Form of DNA 11 1.3.2 Stoichiometries and Topologies of i- Motif DNA 11 ii 1.3.3 Possible Biological Role of i- Motif Structure...

Ngày tải lên: 11/09/2015, 16:04

... TGGCGTTAGAGGAAAAGGTTAGGGGTTAGG 3’ 5’ TGGCGTTAGAGGAAAAGGTTAGAGGTTAGG 3’ 5’ TGGGGTTAGGGGAAAAGGTTTGGGGTTAGG 3’ 5’ TGGGGTTAGGGGAAAAGGTTTTGGGGTTAGG 3’ 5’ TGGCGTTAGGGGAAAAAGGTTAGGGGTTAGG 3’ 5’ TGGCGTTAGGGGAAAGGTTAGGGGTTAGG ... TTAGGGTTAGAGTTAGGGTTAAGGT 3’ 5’ TTAGGGTGGGTGGGTGGGT 3’ 5’ TTAGGGTTGGGTTGGGTTGGGT 3’ 5’ TTAGGGTTATGGGTTATGGGTTATGGGT 3’ 5’ TTAGGGTTATTGGGTTATTGGGTTATTGGGT 3’ 5’ GTTAGGGTTAGGGT...

Ngày tải lên: 16/10/2015, 12:00